Incidental Mutation 'V3553:Zfp84'
ID44052
Institutional Source Beutler Lab
Gene Symbol Zfp84
Ensembl Gene ENSMUSG00000046185
Gene Namezinc finger protein 84
SynonymsC86188, 4633401C23Rik, Zfp69, KRAB18, 2210410P13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #V3553 () of strain feckless
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29768552-29779821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 29777247 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 455 (A455S)
Ref Sequence ENSEMBL: ENSMUSP00000032802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032802]
Predicted Effect probably benign
Transcript: ENSMUST00000032802
AA Change: A455S

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032802
Gene: ENSMUSG00000046185
AA Change: A455S

DomainStartEndE-ValueType
KRAB 14 74 9.09e-36 SMART
ZnF_C2H2 249 271 1.67e-2 SMART
ZnF_C2H2 277 299 1.43e-1 SMART
ZnF_C2H2 305 327 5.81e-2 SMART
ZnF_C2H2 333 355 1.95e-3 SMART
ZnF_C2H2 361 383 8.6e-5 SMART
ZnF_C2H2 389 411 2.32e-1 SMART
ZnF_C2H2 417 439 3.89e-3 SMART
ZnF_C2H2 445 467 1.69e-3 SMART
ZnF_C2H2 473 495 9.58e-3 SMART
ZnF_C2H2 501 523 1.38e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158514
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcas3 G A 11: 85,822,100 probably benign Het
Bicral G T 17: 46,830,095 N20K probably damaging Het
Dnah9 C A 11: 65,970,076 G2823C probably damaging Het
Hcfc2 T C 10: 82,712,061 W296R probably damaging Het
Lrp1 C T 10: 127,571,442 G1877S probably damaging Het
Rhbdf1 G A 11: 32,211,583 P575L probably damaging Het
Sh3pxd2a G A 19: 47,267,219 P1048L probably benign Het
Tgm5 C T 2: 121,071,502 V229I probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Tnfrsf21 G A 17: 43,037,931 A145T probably benign Het
Other mutations in Zfp84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Zfp84 APN 7 29776666 missense probably benign 0.16
IGL03022:Zfp84 APN 7 29775334 splice site probably benign
R0666:Zfp84 UTSW 7 29776851 missense probably damaging 1.00
R0781:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1110:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1353:Zfp84 UTSW 7 29776175 missense probably benign 0.02
R1495:Zfp84 UTSW 7 29777303 nonsense probably null
R1496:Zfp84 UTSW 7 29776614 missense possibly damaging 0.53
R1681:Zfp84 UTSW 7 29777400 missense probably damaging 1.00
R1827:Zfp84 UTSW 7 29777343 missense possibly damaging 0.91
R1854:Zfp84 UTSW 7 29775371 missense possibly damaging 0.84
R2209:Zfp84 UTSW 7 29777182 missense probably damaging 0.99
R2843:Zfp84 UTSW 7 29775333 splice site probably null
R2844:Zfp84 UTSW 7 29775333 splice site probably null
R4691:Zfp84 UTSW 7 29777080 missense probably damaging 1.00
R5453:Zfp84 UTSW 7 29776297 missense possibly damaging 0.82
R5474:Zfp84 UTSW 7 29777089 missense probably damaging 1.00
R5578:Zfp84 UTSW 7 29775431 missense possibly damaging 0.93
R5646:Zfp84 UTSW 7 29776393 missense probably benign 0.05
R5963:Zfp84 UTSW 7 29776953 missense probably damaging 1.00
R6830:Zfp84 UTSW 7 29776486 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCATACGAATGCCACAAATGTCAG -3'
(R):5'- TCACCTGTAAGAGCCGAGTGAAGG -3'

Sequencing Primer
(F):5'- ccacagcggcgagaaac -3'
(R):5'- ACACTCGTAGGGCTTCTCG -3'
Posted On2013-05-31