Incidental Mutation 'R5641:Ube4a'
ID440676
Institutional Source Beutler Lab
Gene Symbol Ube4a
Ensembl Gene ENSMUSG00000059890
Gene Nameubiquitination factor E4A
Synonyms9930123J21Rik, UFD2b, 4732444G18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5641 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44923127-44965600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44950881 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 173 (M173K)
Ref Sequence ENSEMBL: ENSMUSP00000149477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000125642] [ENSMUST00000138559] [ENSMUST00000145657] [ENSMUST00000154287] [ENSMUST00000213193] [ENSMUST00000213666] [ENSMUST00000213890] [ENSMUST00000214761]
Predicted Effect probably damaging
Transcript: ENSMUST00000117506
AA Change: M154K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890
AA Change: M154K

DomainStartEndE-ValueType
low complexity region 288 299 N/A INTRINSIC
Pfam:Ufd2P_core 330 766 2.6e-101 PFAM
Pfam:Ufd2P_core 762 935 7.4e-61 PFAM
Ubox 953 1016 1.9e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117549
AA Change: M173K

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890
AA Change: M173K

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 991 3.4e-155 PFAM
Ubox 1010 1073 1.9e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125642
Predicted Effect probably damaging
Transcript: ENSMUST00000138559
AA Change: M173K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000145657
Predicted Effect probably benign
Transcript: ENSMUST00000154287
AA Change: M173K

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890
AA Change: M173K

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 547 4.1e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213193
AA Change: M173K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000213666
Predicted Effect probably damaging
Transcript: ENSMUST00000213890
AA Change: M173K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000214761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215720
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,472,013 M1398L probably benign Het
Acad12 A G 5: 121,604,021 probably benign Het
Aldh1a7 T C 19: 20,715,929 I209V probably benign Het
Alkal2 G A 12: 30,887,265 probably null Het
Aqr A G 2: 114,149,034 F307L probably damaging Het
Atp2a2 A G 5: 122,457,576 L932P probably damaging Het
Atxn7 T C 14: 14,013,638 M113T probably damaging Het
Blzf1 T A 1: 164,306,469 M4L probably benign Het
Brca2 C A 5: 150,556,899 S2711R probably damaging Het
Bzw1 A T 1: 58,397,724 Q70L probably damaging Het
Cd34 T A 1: 194,947,968 I70N probably benign Het
Chac1 A G 2: 119,351,518 Y39C probably damaging Het
Col6a2 G C 10: 76,613,278 P275A probably damaging Het
Crb1 T A 1: 139,248,889 N452I probably damaging Het
Ctrc T C 4: 141,838,783 N188S probably damaging Het
Dnah7b G A 1: 46,268,764 probably null Het
Etl4 GGGGAAGAACCGG GGG 2: 20,806,462 probably null Het
Exoc6 T A 19: 37,587,633 probably null Het
Gm5616 T A 9: 48,450,416 noncoding transcript Het
Gm7535 T C 17: 17,911,526 probably benign Het
Hnrnpr T C 4: 136,332,487 S200P probably damaging Het
Ighg2b T C 12: 113,307,147 N121S unknown Het
Il21 T A 3: 37,227,768 K76* probably null Het
Jup T A 11: 100,376,806 T564S possibly damaging Het
Kcns2 G C 15: 34,839,053 R187S possibly damaging Het
Klhl18 G A 9: 110,446,828 T84M probably damaging Het
Mtor T A 4: 148,546,425 L2280M probably damaging Het
Ncoa6 A G 2: 155,421,836 I226T probably benign Het
Nipbl A T 15: 8,366,712 Y126N possibly damaging Het
Nlrp4a T A 7: 26,450,164 C399S probably damaging Het
Nphp3 A G 9: 104,036,153 K54E probably damaging Het
Nsun2 T A 13: 69,623,249 V326E probably benign Het
Olfr725 A G 14: 50,035,289 I38T probably benign Het
Oosp3 T C 19: 11,697,173 probably null Het
Pcdhga9 T C 18: 37,738,248 S377P probably damaging Het
Pdlim3 A G 8: 45,915,263 probably null Het
Pla2r1 A T 2: 60,514,984 W343R probably damaging Het
Prox2 A G 12: 85,087,947 V520A probably benign Het
Rfx3 T C 19: 27,793,608 probably null Het
Rif1 A C 2: 52,121,158 R2412S possibly damaging Het
Rreb1 T C 13: 37,947,421 L1517P probably benign Het
Rxfp1 T C 3: 79,686,892 N65S probably damaging Het
Sbf2 T C 7: 110,438,901 E399G probably damaging Het
Slc36a4 A C 9: 15,728,802 probably null Het
Slco1a1 A T 6: 141,939,969 M110K probably damaging Het
Stat5a T A 11: 100,876,808 C401S probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem150c T C 5: 100,083,664 T151A probably damaging Het
Vmn1r188 A T 13: 22,088,172 S99C probably damaging Het
Vmn2r70 C T 7: 85,559,364 C635Y probably damaging Het
Zfp644 T C 5: 106,619,595 K24E probably damaging Het
Other mutations in Ube4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ube4a APN 9 44948141 missense probably damaging 1.00
IGL00857:Ube4a APN 9 44932386 missense probably damaging 1.00
IGL01067:Ube4a APN 9 44944865 missense probably damaging 0.96
broadway UTSW 9 44939960 critical splice donor site probably null
White_way UTSW 9 44949753 nonsense probably null
R0243:Ube4a UTSW 9 44946178 unclassified probably benign
R0355:Ube4a UTSW 9 44944801 splice site probably benign
R0680:Ube4a UTSW 9 44948060 missense probably damaging 1.00
R0863:Ube4a UTSW 9 44949816 missense possibly damaging 0.55
R0909:Ube4a UTSW 9 44939973 missense probably damaging 0.97
R1597:Ube4a UTSW 9 44929766 missense possibly damaging 0.93
R1611:Ube4a UTSW 9 44956737 intron probably benign
R1871:Ube4a UTSW 9 44944937 splice site probably null
R2069:Ube4a UTSW 9 44948099 missense probably damaging 0.96
R2518:Ube4a UTSW 9 44948137 missense probably benign 0.29
R3079:Ube4a UTSW 9 44960073 missense probably damaging 1.00
R3404:Ube4a UTSW 9 44929687 missense probably damaging 1.00
R3726:Ube4a UTSW 9 44933323 missense probably damaging 0.97
R3758:Ube4a UTSW 9 44949900 unclassified probably benign
R4027:Ube4a UTSW 9 44949900 unclassified probably benign
R4029:Ube4a UTSW 9 44949900 unclassified probably benign
R4111:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4113:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4238:Ube4a UTSW 9 44939999 missense probably damaging 1.00
R4365:Ube4a UTSW 9 44960081 missense probably damaging 1.00
R4471:Ube4a UTSW 9 44946532 unclassified probably benign
R4793:Ube4a UTSW 9 44948822 missense probably damaging 1.00
R5069:Ube4a UTSW 9 44940089 missense probably damaging 1.00
R5214:Ube4a UTSW 9 44948868 missense probably benign 0.22
R5225:Ube4a UTSW 9 44939960 critical splice donor site probably null
R5416:Ube4a UTSW 9 44941178 missense probably damaging 0.99
R5729:Ube4a UTSW 9 44933329 missense probably damaging 1.00
R5774:Ube4a UTSW 9 44953097 missense probably damaging 0.99
R5908:Ube4a UTSW 9 44948024 critical splice donor site probably null
R6191:Ube4a UTSW 9 44949753 nonsense probably null
R6752:Ube4a UTSW 9 44925948 missense probably damaging 1.00
R6886:Ube4a UTSW 9 44948843 missense probably damaging 0.96
R6911:Ube4a UTSW 9 44942758 missense probably damaging 1.00
X0025:Ube4a UTSW 9 44942818 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GACACTGAGCCAACTCTCTC -3'
(R):5'- TCTGCTGTGACTATCCCAGAC -3'

Sequencing Primer
(F):5'- TCTCTCTCACACATGCTAACATCAC -3'
(R):5'- TCTAACATTCCTGAATAAGATTCCCC -3'
Posted On2016-11-08