Incidental Mutation 'V5088:Or2n1d'
ID 44069
Institutional Source Beutler Lab
Gene Symbol Or2n1d
Ensembl Gene ENSMUSG00000096840
Gene Name olfactory receptor family 2 subfamily N member 1D
Synonyms Olfr136, MOR256-7, GA_x6K02T2PSCP-2779375-2780313
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # V5088 () of strain 521
Quality Score 200
Status Not validated
Chromosome 17
Chromosomal Location 38646050-38646988 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to G at 38646050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000149856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]
AlphaFold Q8VG72
Predicted Effect probably null
Transcript: ENSMUST00000077203
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: M1V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-48 PFAM
Pfam:7tm_1 41 290 7.1e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000208525
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000208539
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000214035
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000216963
AA Change: M1V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 7 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 148,026,233 (GRCm39) S251F probably benign Het
Akap8l C G 17: 32,555,713 (GRCm39) probably null Het
Ccar2 G T 14: 70,388,738 (GRCm39) L158I probably damaging Het
Megf11 C A 9: 64,597,351 (GRCm39) C674* probably null Het
Psme4 A G 11: 30,801,210 (GRCm39) E1455G probably benign Het
Wdr17 C T 8: 55,146,131 (GRCm39) A90T possibly damaging Het
Zbtb12 C A 17: 35,115,277 (GRCm39) A354E possibly damaging Het
Other mutations in Or2n1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Or2n1d APN 17 38,646,848 (GRCm39) missense probably benign 0.00
IGL01787:Or2n1d APN 17 38,646,470 (GRCm39) missense probably damaging 0.98
IGL02480:Or2n1d APN 17 38,646,314 (GRCm39) missense probably benign 0.32
IGL02603:Or2n1d APN 17 38,646,404 (GRCm39) missense probably damaging 1.00
IGL03122:Or2n1d APN 17 38,646,192 (GRCm39) missense probably benign 0.01
BB009:Or2n1d UTSW 17 38,646,146 (GRCm39) missense probably benign 0.01
BB019:Or2n1d UTSW 17 38,646,146 (GRCm39) missense probably benign 0.01
R0295:Or2n1d UTSW 17 38,646,182 (GRCm39) missense probably damaging 1.00
R0684:Or2n1d UTSW 17 38,646,735 (GRCm39) missense probably benign 0.11
R1874:Or2n1d UTSW 17 38,646,860 (GRCm39) missense probably damaging 1.00
R3436:Or2n1d UTSW 17 38,646,323 (GRCm39) missense probably damaging 1.00
R3437:Or2n1d UTSW 17 38,646,323 (GRCm39) missense probably damaging 1.00
R4714:Or2n1d UTSW 17 38,646,731 (GRCm39) missense possibly damaging 0.65
R4715:Or2n1d UTSW 17 38,646,731 (GRCm39) missense possibly damaging 0.65
R4716:Or2n1d UTSW 17 38,646,731 (GRCm39) missense possibly damaging 0.65
R4878:Or2n1d UTSW 17 38,646,518 (GRCm39) missense probably benign
R5296:Or2n1d UTSW 17 38,646,347 (GRCm39) nonsense probably null
R5370:Or2n1d UTSW 17 38,646,335 (GRCm39) nonsense probably null
R5413:Or2n1d UTSW 17 38,646,515 (GRCm39) missense probably benign 0.03
R5988:Or2n1d UTSW 17 38,646,911 (GRCm39) missense probably damaging 1.00
R6156:Or2n1d UTSW 17 38,646,064 (GRCm39) missense probably damaging 0.99
R6550:Or2n1d UTSW 17 38,646,896 (GRCm39) missense possibly damaging 0.65
R7395:Or2n1d UTSW 17 38,646,755 (GRCm39) nonsense probably null
R7417:Or2n1d UTSW 17 38,646,183 (GRCm39) missense probably damaging 1.00
R7746:Or2n1d UTSW 17 38,646,285 (GRCm39) missense probably benign 0.16
R7747:Or2n1d UTSW 17 38,646,285 (GRCm39) missense probably benign 0.16
R7821:Or2n1d UTSW 17 38,646,855 (GRCm39) missense probably benign 0.13
R7932:Or2n1d UTSW 17 38,646,146 (GRCm39) missense probably benign 0.01
R8409:Or2n1d UTSW 17 38,646,197 (GRCm39) missense probably benign 0.09
R8911:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R8912:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R8913:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R8914:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R8968:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9006:Or2n1d UTSW 17 38,646,723 (GRCm39) missense possibly damaging 0.84
R9044:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9110:Or2n1d UTSW 17 38,646,434 (GRCm39) missense probably damaging 1.00
R9155:Or2n1d UTSW 17 38,646,224 (GRCm39) missense probably damaging 0.99
R9279:Or2n1d UTSW 17 38,646,414 (GRCm39) missense probably damaging 0.99
R9289:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9295:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9317:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9318:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9348:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9409:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9410:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9411:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9412:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9413:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9512:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9522:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
R9524:Or2n1d UTSW 17 38,646,540 (GRCm39) nonsense probably null
R9547:Or2n1d UTSW 17 38,646,341 (GRCm39) missense possibly damaging 0.80
R9580:Or2n1d UTSW 17 38,646,320 (GRCm39) missense possibly damaging 0.94
Z1176:Or2n1d UTSW 17 38,646,243 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTAGCAGTGGCTTCATGATCAG -3'
(R):5'- GGTTGACACCAGAATGATGGCGATG -3'

Sequencing Primer
(F):5'- acttttaagcactgtgtaagctc -3'
(R):5'- CAGAATGATGGCGATGTTCCC -3'
Posted On 2013-05-31