Incidental Mutation 'R5641:Atxn7'
ID 440690
Institutional Source Beutler Lab
Gene Symbol Atxn7
Ensembl Gene ENSMUSG00000021738
Gene Name ataxin 7
Synonyms Sca7, A430107N12Rik, ataxin-7
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5641 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 8362461-8508323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14013638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 113 (M113T)
Ref Sequence ENSEMBL: ENSMUSP00000152934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]
AlphaFold Q8R4I1
Predicted Effect probably damaging
Transcript: ENSMUST00000022257
AA Change: M113T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738
AA Change: M113T

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223714
AA Change: M113T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223880
AA Change: M113T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226073
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,289,877 (GRCm39) M1398L probably benign Het
Acad12 A G 5: 121,742,084 (GRCm39) probably benign Het
Aldh1a7 T C 19: 20,693,293 (GRCm39) I209V probably benign Het
Alkal2 G A 12: 30,937,264 (GRCm39) probably null Het
Aqr A G 2: 113,979,515 (GRCm39) F307L probably damaging Het
Atp2a2 A G 5: 122,595,639 (GRCm39) L932P probably damaging Het
Blzf1 T A 1: 164,134,038 (GRCm39) M4L probably benign Het
Brca2 C A 5: 150,480,364 (GRCm39) S2711R probably damaging Het
Bzw1 A T 1: 58,436,883 (GRCm39) Q70L probably damaging Het
Cd34 T A 1: 194,630,276 (GRCm39) I70N probably benign Het
Chac1 A G 2: 119,181,999 (GRCm39) Y39C probably damaging Het
Col6a2 G C 10: 76,449,112 (GRCm39) P275A probably damaging Het
Crb1 T A 1: 139,176,627 (GRCm39) N452I probably damaging Het
Ctrc T C 4: 141,566,094 (GRCm39) N188S probably damaging Het
Dnah7b G A 1: 46,307,924 (GRCm39) probably null Het
Etl4 GGGGAAGAACCGG GGG 2: 20,811,273 (GRCm39) probably null Het
Exoc6 T A 19: 37,576,081 (GRCm39) probably null Het
Gm5616 T A 9: 48,361,716 (GRCm39) noncoding transcript Het
Gm7535 T C 17: 18,131,788 (GRCm39) probably benign Het
Hnrnpr T C 4: 136,059,798 (GRCm39) S200P probably damaging Het
Ighg2b T C 12: 113,270,767 (GRCm39) N121S unknown Het
Il21 T A 3: 37,281,917 (GRCm39) K76* probably null Het
Jup T A 11: 100,267,632 (GRCm39) T564S possibly damaging Het
Kcns2 G C 15: 34,839,199 (GRCm39) R187S possibly damaging Het
Klhl18 G A 9: 110,275,896 (GRCm39) T84M probably damaging Het
Mtor T A 4: 148,630,882 (GRCm39) L2280M probably damaging Het
Ncoa6 A G 2: 155,263,756 (GRCm39) I226T probably benign Het
Nipbl A T 15: 8,396,196 (GRCm39) Y126N possibly damaging Het
Nlrp4a T A 7: 26,149,589 (GRCm39) C399S probably damaging Het
Nphp3 A G 9: 103,913,352 (GRCm39) K54E probably damaging Het
Nsun2 T A 13: 69,771,368 (GRCm39) V326E probably benign Het
Oosp3 T C 19: 11,674,537 (GRCm39) probably null Het
Or4k15b A G 14: 50,272,746 (GRCm39) I38T probably benign Het
Pcdhga9 T C 18: 37,871,301 (GRCm39) S377P probably damaging Het
Pdlim3 A G 8: 46,368,300 (GRCm39) probably null Het
Pla2r1 A T 2: 60,345,328 (GRCm39) W343R probably damaging Het
Prox2 A G 12: 85,134,721 (GRCm39) V520A probably benign Het
Rfx3 T C 19: 27,771,008 (GRCm39) probably null Het
Rif1 A C 2: 52,011,170 (GRCm39) R2412S possibly damaging Het
Rreb1 T C 13: 38,131,397 (GRCm39) L1517P probably benign Het
Rxfp1 T C 3: 79,594,199 (GRCm39) N65S probably damaging Het
Sbf2 T C 7: 110,038,108 (GRCm39) E399G probably damaging Het
Slc36a4 A C 9: 15,640,098 (GRCm39) probably null Het
Slco1a1 A T 6: 141,885,695 (GRCm39) M110K probably damaging Het
Stat5a T A 11: 100,767,634 (GRCm39) C401S probably benign Het
Ticam1 TCACACA TCACA 17: 56,577,629 (GRCm39) probably null Het
Tmem150c T C 5: 100,231,523 (GRCm39) T151A probably damaging Het
Ube4a A T 9: 44,862,179 (GRCm39) M173K probably damaging Het
Vmn1r188 A T 13: 22,272,342 (GRCm39) S99C probably damaging Het
Vmn2r70 C T 7: 85,208,572 (GRCm39) C635Y probably damaging Het
Zfp644 T C 5: 106,767,461 (GRCm39) K24E probably damaging Het
Other mutations in Atxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Atxn7 APN 14 14,096,324 (GRCm38) splice site probably benign
IGL00782:Atxn7 APN 14 14,096,218 (GRCm38) missense possibly damaging 0.78
IGL01405:Atxn7 APN 14 14,100,105 (GRCm38) missense probably benign 0.00
IGL02828:Atxn7 APN 14 14,090,056 (GRCm38) missense probably damaging 1.00
IGL03119:Atxn7 APN 14 14,100,734 (GRCm38) missense probably damaging 1.00
IGL03139:Atxn7 APN 14 14,052,994 (GRCm38) missense probably damaging 0.97
IGL03282:Atxn7 APN 14 14,100,564 (GRCm38) missense probably damaging 0.99
IGL03387:Atxn7 APN 14 14,087,273 (GRCm38) splice site probably benign
Estes_park UTSW 14 14,096,317 (GRCm38) critical splice donor site probably null
Lumpy UTSW 14 14,089,446 (GRCm38) nonsense probably null
Oestes_park UTSW 14 14,096,268 (GRCm38) nonsense probably null
R0034:Atxn7 UTSW 14 14,100,846 (GRCm38) missense probably damaging 0.96
R0408:Atxn7 UTSW 14 14,100,317 (GRCm38) missense probably damaging 1.00
R0853:Atxn7 UTSW 14 14,089,465 (GRCm38) splice site probably benign
R1169:Atxn7 UTSW 14 14,095,468 (GRCm38) missense possibly damaging 0.81
R1678:Atxn7 UTSW 14 14,096,239 (GRCm38) missense probably damaging 1.00
R1802:Atxn7 UTSW 14 14,089,419 (GRCm38) missense probably benign 0.25
R2078:Atxn7 UTSW 14 14,052,975 (GRCm38) missense probably damaging 0.99
R2275:Atxn7 UTSW 14 14,013,268 (GRCm38) missense possibly damaging 0.85
R2394:Atxn7 UTSW 14 14,100,237 (GRCm38) missense probably damaging 1.00
R4118:Atxn7 UTSW 14 14,100,308 (GRCm38) missense probably benign 0.00
R4230:Atxn7 UTSW 14 14,100,381 (GRCm38) missense probably benign 0.00
R4588:Atxn7 UTSW 14 14,096,268 (GRCm38) nonsense probably null
R4688:Atxn7 UTSW 14 14,089,288 (GRCm38) missense probably benign 0.00
R4935:Atxn7 UTSW 14 14,100,401 (GRCm38) missense probably benign
R5041:Atxn7 UTSW 14 14,096,317 (GRCm38) critical splice donor site probably null
R5185:Atxn7 UTSW 14 14,090,063 (GRCm38) missense probably benign 0.04
R5561:Atxn7 UTSW 14 14,089,260 (GRCm38) missense probably benign 0.19
R6490:Atxn7 UTSW 14 14,089,446 (GRCm38) nonsense probably null
R6549:Atxn7 UTSW 14 14,013,087 (GRCm38) missense probably damaging 0.99
R6623:Atxn7 UTSW 14 14,099,972 (GRCm38) missense probably damaging 1.00
R6950:Atxn7 UTSW 14 14,095,511 (GRCm38) missense probably damaging 1.00
R7054:Atxn7 UTSW 14 14,100,878 (GRCm38) missense probably benign 0.08
R7402:Atxn7 UTSW 14 14,095,427 (GRCm38) missense probably damaging 0.98
R7762:Atxn7 UTSW 14 14,100,467 (GRCm38) missense probably damaging 1.00
R8432:Atxn7 UTSW 14 14,013,635 (GRCm38) missense probably benign 0.06
R8786:Atxn7 UTSW 14 14,103,316 (GRCm38) missense possibly damaging 0.78
R9238:Atxn7 UTSW 14 14,089,441 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGATGCTATCTTCTGCTG -3'
(R):5'- GCCCATCACTTTGAATTGCC -3'

Sequencing Primer
(F):5'- TTCTGCTGGGTGCCCACAC -3'
(R):5'- TTGCTGCCCATTACAGAGAG -3'
Posted On 2016-11-08