Incidental Mutation 'R5644:St14'
ID440976
Institutional Source Beutler Lab
Gene Symbol St14
Ensembl Gene ENSMUSG00000031995
Gene Namesuppression of tumorigenicity 14 (colon carcinoma)
SynonymsMT-SP1, matriptase, Tmprss14, Prss14, Epithin
MMRRC Submission 043292-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5644 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location31089402-31131853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31106510 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 205 (M205V)
Ref Sequence ENSEMBL: ENSMUSP00000034478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034478] [ENSMUST00000123557] [ENSMUST00000214418]
Predicted Effect probably benign
Transcript: ENSMUST00000034478
AA Change: M205V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995
AA Change: M205V

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
Pfam:SEA 88 181 7.9e-17 PFAM
CUB 214 334 4.24e-14 SMART
CUB 340 447 4.37e-25 SMART
LDLa 452 486 2.31e-9 SMART
LDLa 487 523 4.08e-10 SMART
LDLa 524 561 3.98e-13 SMART
LDLa 566 604 1.48e-7 SMART
Tryp_SPc 614 849 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148789
Predicted Effect probably benign
Transcript: ENSMUST00000214418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217404
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A T 10: 14,432,934 D805E probably damaging Het
Adrb2 A T 18: 62,178,682 N357K probably benign Het
Ahnak A G 19: 9,010,657 K3102E possibly damaging Het
Alkal2 T A 12: 30,884,890 L36Q probably damaging Het
Alkbh8 G T 9: 3,385,384 V559F probably damaging Het
Apba2 A G 7: 64,715,511 T346A probably benign Het
Arhgap10 C T 8: 77,411,055 M302I probably benign Het
Asah1 G T 8: 41,360,295 T27K possibly damaging Het
Bag2 A G 1: 33,746,953 V96A probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
C4b T C 17: 34,742,417 I189M probably benign Het
Cacna1a A G 8: 84,462,777 Y119C probably damaging Het
Calcr A G 6: 3,708,538 I216T probably damaging Het
Ccar1 T C 10: 62,771,978 N302S probably benign Het
Ccdc93 A G 1: 121,483,336 H446R probably benign Het
Cct6b A T 11: 82,722,455 L420Q probably benign Het
Cemip T C 7: 83,989,184 T273A probably benign Het
Cep128 A T 12: 91,348,851 I87K probably damaging Het
Cfap221 A G 1: 119,932,802 L698P probably damaging Het
Cfap43 T A 19: 47,795,675 N473I possibly damaging Het
Clec12b T A 6: 129,379,960 I172L probably benign Het
Cntnap5b A C 1: 100,383,601 E606D probably benign Het
Cyp2c67 A C 19: 39,615,694 V406G possibly damaging Het
Dhx57 T C 17: 80,238,873 I1308V possibly damaging Het
Dnah7a A T 1: 53,540,979 M1599K probably benign Het
Dnajc21 A T 15: 10,461,915 D133E probably benign Het
Dpp8 G A 9: 65,045,735 W231* probably null Het
Dvl3 T A 16: 20,526,276 I353N probably damaging Het
Fgd6 T A 10: 94,134,050 I1187N possibly damaging Het
Fn1 A T 1: 71,627,250 Y875N probably damaging Het
Gaa T A 11: 119,280,535 M671K possibly damaging Het
Gm11939 T C 11: 99,559,312 D52G probably damaging Het
Gm14403 A T 2: 177,507,261 H50L possibly damaging Het
Gpam A T 19: 55,088,899 D153E probably benign Het
Gzma T C 13: 113,098,260 T66A probably damaging Het
Hnmt A T 2: 24,014,239 W137R probably damaging Het
Hsd17b7 A T 1: 169,955,948 V297D probably damaging Het
Ighv1-85 A T 12: 116,000,060 S107T possibly damaging Het
Kif12 T A 4: 63,165,893 Q624L possibly damaging Het
Kif1b T C 4: 149,238,482 D660G probably damaging Het
Klf13 T C 7: 63,891,560 probably benign Het
Klhl41 A G 2: 69,670,471 Y92C probably damaging Het
Klrc2 A T 6: 129,656,457 C186S probably damaging Het
Lao1 T A 4: 118,965,236 probably null Het
Lmo7 A G 14: 101,929,336 probably benign Het
Lyst A T 13: 13,637,496 Q831L possibly damaging Het
Lzts1 A G 8: 69,139,077 S140P possibly damaging Het
Man2b1 T A 8: 85,094,210 I679N possibly damaging Het
Mgat5b T A 11: 116,973,400 V464E probably damaging Het
Mrgprb5 G A 7: 48,168,207 T260I probably benign Het
Mybpc2 T C 7: 44,507,053 T825A probably benign Het
Mycbp2 T A 14: 103,287,334 K597I probably damaging Het
Naalad2 G T 9: 18,334,931 N568K possibly damaging Het
Neurl1a A G 19: 47,179,477 N4S probably benign Het
Nfx1 T C 4: 40,984,973 W366R probably null Het
Nipbl C T 15: 8,358,907 V410I probably benign Het
Nlrp9a A T 7: 26,558,568 H537L possibly damaging Het
Nxpe4 A G 9: 48,392,750 N46D probably benign Het
Olfr1037 T C 2: 86,085,159 N206S probably damaging Het
Olfr116 T A 17: 37,624,432 I68F probably benign Het
Olfr1188 T A 2: 88,559,505 M1K probably null Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1443 A T 19: 12,680,972 Y288F probably damaging Het
Olfr290 C A 7: 84,916,119 F113L probably benign Het
Olfr482 A T 7: 108,094,804 Y255* probably null Het
Olfr484 A G 7: 108,124,651 F204S probably benign Het
Olfr791 A T 10: 129,527,103 N292I probably damaging Het
Olfr813 T A 10: 129,857,427 V303E probably benign Het
P2ry12 A T 3: 59,218,095 M53K possibly damaging Het
Pcca G A 14: 122,887,069 C684Y probably damaging Het
Pdzd7 A G 19: 45,040,180 S175P probably benign Het
Pgbd1 A G 13: 21,423,152 C291R probably damaging Het
Plekhg5 T C 4: 152,104,340 V200A probably benign Het
Pola2 A G 19: 5,961,170 V42A probably benign Het
Pramef25 C T 4: 143,948,804 G484D probably benign Het
Prkcd C A 14: 30,607,413 K23N probably benign Het
Ptdss1 T C 13: 66,972,540 F267L probably damaging Het
Rad54l C T 4: 116,098,947 S561N probably benign Het
Rai14 T A 15: 10,593,051 H169L probably benign Het
Rfc3 C T 5: 151,649,979 V40I probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Rtl1 C T 12: 109,591,579 M1275I probably benign Het
Ryr2 C A 13: 11,595,582 E4119D probably damaging Het
Senp7 T C 16: 56,184,149 silent Het
Sfmbt2 A T 2: 10,568,373 I571F probably damaging Het
Sit1 T A 4: 43,483,562 T8S probably benign Het
Slc22a30 T C 19: 8,404,616 H97R possibly damaging Het
Slco1a5 A C 6: 142,237,594 probably null Het
Smc6 T A 12: 11,289,994 N434K probably benign Het
Snap91 G T 9: 86,790,153 probably null Het
Srsf10 T C 4: 135,863,820 S194P possibly damaging Het
Syndig1 A T 2: 149,899,508 I5F possibly damaging Het
Tbrg1 T C 9: 37,649,413 D389G probably benign Het
Tcaf2 G A 6: 42,642,773 R107C possibly damaging Het
Tpmt T A 13: 47,028,959 D163V probably benign Het
Trim15 T C 17: 36,866,821 E94G probably damaging Het
Trit1 T C 4: 123,049,172 I279T probably damaging Het
Trpm8 T A 1: 88,359,739 F815I possibly damaging Het
Ttn T A 2: 76,938,523 T2856S probably damaging Het
Ugdh A T 5: 65,416,861 D446E probably benign Het
Unc5c C T 3: 141,678,125 A88V probably damaging Het
Vmn1r43 T C 6: 89,870,372 N44S probably damaging Het
Vmn2r120 T A 17: 57,524,977 M271L probably benign Het
Wdr74 T A 19: 8,737,876 V133E probably damaging Het
Zfp607b T C 7: 27,703,769 L550P probably damaging Het
Other mutations in St14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:St14 APN 9 31103779 missense probably damaging 1.00
IGL01443:St14 APN 9 31100193 nonsense probably null
IGL01816:St14 APN 9 31108267 missense possibly damaging 0.71
IGL02100:St14 APN 9 31100130 splice site probably benign
IGL02494:St14 APN 9 31108645 missense possibly damaging 0.47
IGL02588:St14 APN 9 31090033 splice site probably benign
IGL02663:St14 APN 9 31100382 splice site probably null
IGL02711:St14 APN 9 31089900 missense probably benign 0.05
IGL03130:St14 APN 9 31097071 critical splice donor site probably null
IGL03296:St14 APN 9 31108712 missense probably damaging 0.98
IGL03400:St14 APN 9 31096971 splice site probably benign
R0101:St14 UTSW 9 31097107 missense probably benign 0.23
R0225:St14 UTSW 9 31108284 critical splice acceptor site probably null
R0335:St14 UTSW 9 31091324 splice site probably benign
R0892:St14 UTSW 9 31100428 missense probably benign 0.38
R1334:St14 UTSW 9 31108210 missense probably damaging 1.00
R1487:St14 UTSW 9 31097180 missense probably damaging 1.00
R1521:St14 UTSW 9 31108215 missense probably benign 0.03
R1782:St14 UTSW 9 31100164 missense probably damaging 1.00
R1920:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1921:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1922:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1933:St14 UTSW 9 31106212 missense probably benign 0.00
R2070:St14 UTSW 9 31091373 missense probably damaging 1.00
R2411:St14 UTSW 9 31108234 missense probably benign 0.13
R4152:St14 UTSW 9 31090506 missense probably benign 0.08
R4375:St14 UTSW 9 31090458 missense probably benign 0.02
R4419:St14 UTSW 9 31096928 missense probably damaging 1.00
R4747:St14 UTSW 9 31103757 missense possibly damaging 0.78
R4791:St14 UTSW 9 31095622 missense probably benign 0.27
R4915:St14 UTSW 9 31108664 nonsense probably null
R5056:St14 UTSW 9 31097551 splice site probably null
R5134:St14 UTSW 9 31095583 missense probably benign 0.00
R5241:St14 UTSW 9 31100418 nonsense probably null
R5325:St14 UTSW 9 31096978 splice site probably null
R5828:St14 UTSW 9 31091507 missense probably damaging 1.00
R5922:St14 UTSW 9 31129904 intron probably benign
R5930:St14 UTSW 9 31103760 missense probably damaging 1.00
R5963:St14 UTSW 9 31106557 intron probably benign
R6911:St14 UTSW 9 31106785 missense probably benign 0.00
R6937:St14 UTSW 9 31129660 intron probably null
R6986:St14 UTSW 9 31096549 missense probably damaging 0.98
R7226:St14 UTSW 9 31100152 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGCGAACTCAGGTAGACACAAG -3'
(R):5'- TAACATCTGTGGTGGCCTTC -3'

Sequencing Primer
(F):5'- CACAAGGAAAGGAGCTTTGGACC -3'
(R):5'- GAATGTGTGGGCCAGCCTG -3'
Posted On2016-11-08