Incidental Mutation 'R5644:Gaa'
ID440990
Institutional Source Beutler Lab
Gene Symbol Gaa
Ensembl Gene ENSMUSG00000025579
Gene Nameglucosidase, alpha, acid
SynonymsE430018M07Rik
MMRRC Submission 043292-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R5644 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119267887-119285454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119280535 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 671 (M671K)
Ref Sequence ENSEMBL: ENSMUSP00000101866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000106259] [ENSMUST00000132706]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026666
AA Change: M671K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579
AA Change: M671K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106259
AA Change: M671K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579
AA Change: M671K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132706
SMART Domains Protein: ENSMUSP00000119702
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 46 269 2.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138510
Predicted Effect unknown
Transcript: ENSMUST00000143288
AA Change: M147K
SMART Domains Protein: ENSMUSP00000121984
Gene: ENSMUSG00000025579
AA Change: M147K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 8 207 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150562
SMART Domains Protein: ENSMUSP00000115128
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 1 96 4.3e-28 PFAM
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysosomal acid glucosidase that is involved in the degradation of glycogen. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that cleaves alpha-1-4 and alpha-1-6 glycosidic bonds of glycogen, maltose and intermediate oligosaccharides within the lysosome. Mice lacking the encoded protein exhibit symptoms similar to human Pompe syndrome such as accumulation of glycogen in cardiac and skeletal muscle lysosomes resulting in reduced mobility and strength. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to massive glycogen accumulation in multiple organs, cardiomyopathy, hypoactivity, severe motor disability, profound muscle weakness and wasting, and progressive kyphosis. The age of onset and clinical course ofthe disease appear to be strain-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A T 10: 14,432,934 D805E probably damaging Het
Adrb2 A T 18: 62,178,682 N357K probably benign Het
Ahnak A G 19: 9,010,657 K3102E possibly damaging Het
Alkal2 T A 12: 30,884,890 L36Q probably damaging Het
Alkbh8 G T 9: 3,385,384 V559F probably damaging Het
Apba2 A G 7: 64,715,511 T346A probably benign Het
Arhgap10 C T 8: 77,411,055 M302I probably benign Het
Asah1 G T 8: 41,360,295 T27K possibly damaging Het
Bag2 A G 1: 33,746,953 V96A probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
C4b T C 17: 34,742,417 I189M probably benign Het
Cacna1a A G 8: 84,462,777 Y119C probably damaging Het
Calcr A G 6: 3,708,538 I216T probably damaging Het
Ccar1 T C 10: 62,771,978 N302S probably benign Het
Ccdc93 A G 1: 121,483,336 H446R probably benign Het
Cct6b A T 11: 82,722,455 L420Q probably benign Het
Cemip T C 7: 83,989,184 T273A probably benign Het
Cep128 A T 12: 91,348,851 I87K probably damaging Het
Cfap221 A G 1: 119,932,802 L698P probably damaging Het
Cfap43 T A 19: 47,795,675 N473I possibly damaging Het
Clec12b T A 6: 129,379,960 I172L probably benign Het
Cntnap5b A C 1: 100,383,601 E606D probably benign Het
Cyp2c67 A C 19: 39,615,694 V406G possibly damaging Het
Dhx57 T C 17: 80,238,873 I1308V possibly damaging Het
Dnah7a A T 1: 53,540,979 M1599K probably benign Het
Dnajc21 A T 15: 10,461,915 D133E probably benign Het
Dpp8 G A 9: 65,045,735 W231* probably null Het
Dvl3 T A 16: 20,526,276 I353N probably damaging Het
Fgd6 T A 10: 94,134,050 I1187N possibly damaging Het
Fn1 A T 1: 71,627,250 Y875N probably damaging Het
Gm11939 T C 11: 99,559,312 D52G probably damaging Het
Gm14403 A T 2: 177,507,261 H50L possibly damaging Het
Gpam A T 19: 55,088,899 D153E probably benign Het
Gzma T C 13: 113,098,260 T66A probably damaging Het
Hnmt A T 2: 24,014,239 W137R probably damaging Het
Hsd17b7 A T 1: 169,955,948 V297D probably damaging Het
Ighv1-85 A T 12: 116,000,060 S107T possibly damaging Het
Kif12 T A 4: 63,165,893 Q624L possibly damaging Het
Kif1b T C 4: 149,238,482 D660G probably damaging Het
Klf13 T C 7: 63,891,560 probably benign Het
Klhl41 A G 2: 69,670,471 Y92C probably damaging Het
Klrc2 A T 6: 129,656,457 C186S probably damaging Het
Lao1 T A 4: 118,965,236 probably null Het
Lmo7 A G 14: 101,929,336 probably benign Het
Lyst A T 13: 13,637,496 Q831L possibly damaging Het
Lzts1 A G 8: 69,139,077 S140P possibly damaging Het
Man2b1 T A 8: 85,094,210 I679N possibly damaging Het
Mgat5b T A 11: 116,973,400 V464E probably damaging Het
Mrgprb5 G A 7: 48,168,207 T260I probably benign Het
Mybpc2 T C 7: 44,507,053 T825A probably benign Het
Mycbp2 T A 14: 103,287,334 K597I probably damaging Het
Naalad2 G T 9: 18,334,931 N568K possibly damaging Het
Neurl1a A G 19: 47,179,477 N4S probably benign Het
Nfx1 T C 4: 40,984,973 W366R probably null Het
Nipbl C T 15: 8,358,907 V410I probably benign Het
Nlrp9a A T 7: 26,558,568 H537L possibly damaging Het
Nxpe4 A G 9: 48,392,750 N46D probably benign Het
Olfr1037 T C 2: 86,085,159 N206S probably damaging Het
Olfr116 T A 17: 37,624,432 I68F probably benign Het
Olfr1188 T A 2: 88,559,505 M1K probably null Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1443 A T 19: 12,680,972 Y288F probably damaging Het
Olfr290 C A 7: 84,916,119 F113L probably benign Het
Olfr482 A T 7: 108,094,804 Y255* probably null Het
Olfr484 A G 7: 108,124,651 F204S probably benign Het
Olfr791 A T 10: 129,527,103 N292I probably damaging Het
Olfr813 T A 10: 129,857,427 V303E probably benign Het
P2ry12 A T 3: 59,218,095 M53K possibly damaging Het
Pcca G A 14: 122,887,069 C684Y probably damaging Het
Pdzd7 A G 19: 45,040,180 S175P probably benign Het
Pgbd1 A G 13: 21,423,152 C291R probably damaging Het
Plekhg5 T C 4: 152,104,340 V200A probably benign Het
Pola2 A G 19: 5,961,170 V42A probably benign Het
Pramef25 C T 4: 143,948,804 G484D probably benign Het
Prkcd C A 14: 30,607,413 K23N probably benign Het
Ptdss1 T C 13: 66,972,540 F267L probably damaging Het
Rad54l C T 4: 116,098,947 S561N probably benign Het
Rai14 T A 15: 10,593,051 H169L probably benign Het
Rfc3 C T 5: 151,649,979 V40I probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Rtl1 C T 12: 109,591,579 M1275I probably benign Het
Ryr2 C A 13: 11,595,582 E4119D probably damaging Het
Senp7 T C 16: 56,184,149 silent Het
Sfmbt2 A T 2: 10,568,373 I571F probably damaging Het
Sit1 T A 4: 43,483,562 T8S probably benign Het
Slc22a30 T C 19: 8,404,616 H97R possibly damaging Het
Slco1a5 A C 6: 142,237,594 probably null Het
Smc6 T A 12: 11,289,994 N434K probably benign Het
Snap91 G T 9: 86,790,153 probably null Het
Srsf10 T C 4: 135,863,820 S194P possibly damaging Het
St14 T C 9: 31,106,510 M205V probably benign Het
Syndig1 A T 2: 149,899,508 I5F possibly damaging Het
Tbrg1 T C 9: 37,649,413 D389G probably benign Het
Tcaf2 G A 6: 42,642,773 R107C possibly damaging Het
Tpmt T A 13: 47,028,959 D163V probably benign Het
Trim15 T C 17: 36,866,821 E94G probably damaging Het
Trit1 T C 4: 123,049,172 I279T probably damaging Het
Trpm8 T A 1: 88,359,739 F815I possibly damaging Het
Ttn T A 2: 76,938,523 T2856S probably damaging Het
Ugdh A T 5: 65,416,861 D446E probably benign Het
Unc5c C T 3: 141,678,125 A88V probably damaging Het
Vmn1r43 T C 6: 89,870,372 N44S probably damaging Het
Vmn2r120 T A 17: 57,524,977 M271L probably benign Het
Wdr74 T A 19: 8,737,876 V133E probably damaging Het
Zfp607b T C 7: 27,703,769 L550P probably damaging Het
Other mutations in Gaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Gaa APN 11 119274960 missense probably benign
IGL00780:Gaa APN 11 119274291 unclassified probably null
IGL00975:Gaa APN 11 119274683 missense possibly damaging 0.93
IGL01354:Gaa APN 11 119270568 missense probably benign 0.18
IGL01572:Gaa APN 11 119284177 missense probably benign
IGL01634:Gaa APN 11 119274076 missense possibly damaging 0.79
IGL01724:Gaa APN 11 119275121 missense possibly damaging 0.65
IGL01889:Gaa APN 11 119278297 missense probably benign 0.03
IGL02052:Gaa APN 11 119284195 missense possibly damaging 0.76
IGL02173:Gaa APN 11 119274913 missense probably damaging 1.00
IGL02261:Gaa APN 11 119281265 makesense probably null
IGL02337:Gaa APN 11 119277603 missense probably damaging 1.00
IGL02625:Gaa APN 11 119274733 missense probably damaging 1.00
IGL02818:Gaa APN 11 119276848 missense probably damaging 0.97
R0135:Gaa UTSW 11 119278890 missense probably benign 0.00
R0280:Gaa UTSW 11 119284547 missense probably damaging 1.00
R0479:Gaa UTSW 11 119281236 missense possibly damaging 0.95
R1130:Gaa UTSW 11 119274683 missense probably damaging 0.97
R1132:Gaa UTSW 11 119285059 missense probably damaging 0.99
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1179:Gaa UTSW 11 119281128 missense probably damaging 0.98
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1475:Gaa UTSW 11 119274316 splice site probably null
R1711:Gaa UTSW 11 119280460 missense probably damaging 1.00
R1817:Gaa UTSW 11 119284498 nonsense probably null
R1828:Gaa UTSW 11 119283272 missense probably damaging 0.99
R2013:Gaa UTSW 11 119284583 unclassified probably null
R2126:Gaa UTSW 11 119270282 nonsense probably null
R2179:Gaa UTSW 11 119275058 critical splice acceptor site probably null
R2496:Gaa UTSW 11 119283705 missense possibly damaging 0.53
R2936:Gaa UTSW 11 119283724 missense probably benign 0.02
R4321:Gaa UTSW 11 119270137 missense probably benign 0.20
R4603:Gaa UTSW 11 119278958 missense probably damaging 1.00
R4849:Gaa UTSW 11 119272987 missense possibly damaging 0.95
R5225:Gaa UTSW 11 119276843 missense probably damaging 1.00
R5643:Gaa UTSW 11 119280535 missense possibly damaging 0.96
R6074:Gaa UTSW 11 119284186 missense probably benign 0.07
R6154:Gaa UTSW 11 119278352 missense probably damaging 1.00
R6208:Gaa UTSW 11 119281171 missense probably benign 0.01
R6209:Gaa UTSW 11 119281171 missense probably benign 0.01
R6258:Gaa UTSW 11 119281171 missense probably benign 0.01
R6259:Gaa UTSW 11 119281171 missense probably benign 0.01
R6260:Gaa UTSW 11 119281171 missense probably benign 0.01
X0064:Gaa UTSW 11 119274015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAGAACTATGGGCTCTTG -3'
(R):5'- GGCCTTGGGTTCAACAGAATTTC -3'

Sequencing Primer
(F):5'- AAGGCTGGGTTCAACCTG -3'
(R):5'- TCTGCCCCCAGAGCCTAC -3'
Posted On2016-11-08