Incidental Mutation 'R5644:Ahnak'
ID441022
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene NameAHNAK nucleoprotein (desmoyokin)
Synonyms1110004P15Rik, 2310047C17Rik, DY6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R5644 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8989284-9076919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9010657 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 3102 (K3102E)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092956
AA Change: K3102E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: K3102E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A T 10: 14,432,934 D805E probably damaging Het
Adrb2 A T 18: 62,178,682 N357K probably benign Het
Alkal2 T A 12: 30,884,890 L36Q probably damaging Het
Alkbh8 G T 9: 3,385,384 V559F probably damaging Het
Apba2 A G 7: 64,715,511 T346A probably benign Het
Arhgap10 C T 8: 77,411,055 M302I probably benign Het
Asah1 G T 8: 41,360,295 T27K possibly damaging Het
Bag2 A G 1: 33,746,953 V96A probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
C4b T C 17: 34,742,417 I189M probably benign Het
Cacna1a A G 8: 84,462,777 Y119C probably damaging Het
Calcr A G 6: 3,708,538 I216T probably damaging Het
Ccar1 T C 10: 62,771,978 N302S probably benign Het
Ccdc93 A G 1: 121,483,336 H446R probably benign Het
Cct6b A T 11: 82,722,455 L420Q probably benign Het
Cemip T C 7: 83,989,184 T273A probably benign Het
Cep128 A T 12: 91,348,851 I87K probably damaging Het
Cfap221 A G 1: 119,932,802 L698P probably damaging Het
Cfap43 T A 19: 47,795,675 N473I possibly damaging Het
Clec12b T A 6: 129,379,960 I172L probably benign Het
Cntnap5b A C 1: 100,383,601 E606D probably benign Het
Cyp2c67 A C 19: 39,615,694 V406G possibly damaging Het
Dhx57 T C 17: 80,238,873 I1308V possibly damaging Het
Dnah7a A T 1: 53,540,979 M1599K probably benign Het
Dnajc21 A T 15: 10,461,915 D133E probably benign Het
Dpp8 G A 9: 65,045,735 W231* probably null Het
Dvl3 T A 16: 20,526,276 I353N probably damaging Het
Fgd6 T A 10: 94,134,050 I1187N possibly damaging Het
Fn1 A T 1: 71,627,250 Y875N probably damaging Het
Gaa T A 11: 119,280,535 M671K possibly damaging Het
Gm11939 T C 11: 99,559,312 D52G probably damaging Het
Gm14403 A T 2: 177,507,261 H50L possibly damaging Het
Gpam A T 19: 55,088,899 D153E probably benign Het
Gzma T C 13: 113,098,260 T66A probably damaging Het
Hnmt A T 2: 24,014,239 W137R probably damaging Het
Hsd17b7 A T 1: 169,955,948 V297D probably damaging Het
Ighv1-85 A T 12: 116,000,060 S107T possibly damaging Het
Kif12 T A 4: 63,165,893 Q624L possibly damaging Het
Kif1b T C 4: 149,238,482 D660G probably damaging Het
Klf13 T C 7: 63,891,560 probably benign Het
Klhl41 A G 2: 69,670,471 Y92C probably damaging Het
Klrc2 A T 6: 129,656,457 C186S probably damaging Het
Lao1 T A 4: 118,965,236 probably null Het
Lmo7 A G 14: 101,929,336 probably benign Het
Lyst A T 13: 13,637,496 Q831L possibly damaging Het
Lzts1 A G 8: 69,139,077 S140P possibly damaging Het
Man2b1 T A 8: 85,094,210 I679N possibly damaging Het
Mgat5b T A 11: 116,973,400 V464E probably damaging Het
Mrgprb5 G A 7: 48,168,207 T260I probably benign Het
Mybpc2 T C 7: 44,507,053 T825A probably benign Het
Mycbp2 T A 14: 103,287,334 K597I probably damaging Het
Naalad2 G T 9: 18,334,931 N568K possibly damaging Het
Neurl1a A G 19: 47,179,477 N4S probably benign Het
Nfx1 T C 4: 40,984,973 W366R probably null Het
Nipbl C T 15: 8,358,907 V410I probably benign Het
Nlrp9a A T 7: 26,558,568 H537L possibly damaging Het
Nxpe4 A G 9: 48,392,750 N46D probably benign Het
Olfr1037 T C 2: 86,085,159 N206S probably damaging Het
Olfr116 T A 17: 37,624,432 I68F probably benign Het
Olfr1188 T A 2: 88,559,505 M1K probably null Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1443 A T 19: 12,680,972 Y288F probably damaging Het
Olfr290 C A 7: 84,916,119 F113L probably benign Het
Olfr482 A T 7: 108,094,804 Y255* probably null Het
Olfr484 A G 7: 108,124,651 F204S probably benign Het
Olfr791 A T 10: 129,527,103 N292I probably damaging Het
Olfr813 T A 10: 129,857,427 V303E probably benign Het
P2ry12 A T 3: 59,218,095 M53K possibly damaging Het
Pcca G A 14: 122,887,069 C684Y probably damaging Het
Pdzd7 A G 19: 45,040,180 S175P probably benign Het
Pgbd1 A G 13: 21,423,152 C291R probably damaging Het
Plekhg5 T C 4: 152,104,340 V200A probably benign Het
Pola2 A G 19: 5,961,170 V42A probably benign Het
Pramef25 C T 4: 143,948,804 G484D probably benign Het
Prkcd C A 14: 30,607,413 K23N probably benign Het
Ptdss1 T C 13: 66,972,540 F267L probably damaging Het
Rad54l C T 4: 116,098,947 S561N probably benign Het
Rai14 T A 15: 10,593,051 H169L probably benign Het
Rfc3 C T 5: 151,649,979 V40I probably benign Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Rtl1 C T 12: 109,591,579 M1275I probably benign Het
Ryr2 C A 13: 11,595,582 E4119D probably damaging Het
Senp7 T C 16: 56,184,149 silent Het
Sfmbt2 A T 2: 10,568,373 I571F probably damaging Het
Sit1 T A 4: 43,483,562 T8S probably benign Het
Slc22a30 T C 19: 8,404,616 H97R possibly damaging Het
Slco1a5 A C 6: 142,237,594 probably null Het
Smc6 T A 12: 11,289,994 N434K probably benign Het
Snap91 G T 9: 86,790,153 probably null Het
Srsf10 T C 4: 135,863,820 S194P possibly damaging Het
St14 T C 9: 31,106,510 M205V probably benign Het
Syndig1 A T 2: 149,899,508 I5F possibly damaging Het
Tbrg1 T C 9: 37,649,413 D389G probably benign Het
Tcaf2 G A 6: 42,642,773 R107C possibly damaging Het
Tpmt T A 13: 47,028,959 D163V probably benign Het
Trim15 T C 17: 36,866,821 E94G probably damaging Het
Trit1 T C 4: 123,049,172 I279T probably damaging Het
Trpm8 T A 1: 88,359,739 F815I possibly damaging Het
Ttn T A 2: 76,938,523 T2856S probably damaging Het
Ugdh A T 5: 65,416,861 D446E probably benign Het
Unc5c C T 3: 141,678,125 A88V probably damaging Het
Vmn1r43 T C 6: 89,870,372 N44S probably damaging Het
Vmn2r120 T A 17: 57,524,977 M271L probably benign Het
Wdr74 T A 19: 8,737,876 V133E probably damaging Het
Zfp607b T C 7: 27,703,769 L550P probably damaging Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 9007223 missense probably damaging 0.99
IGL00509:Ahnak APN 19 9009951 missense possibly damaging 0.94
IGL00539:Ahnak APN 19 9007908 missense possibly damaging 0.50
IGL00558:Ahnak APN 19 9004307 missense possibly damaging 0.93
IGL00567:Ahnak APN 19 9013383 missense probably benign 0.24
IGL00706:Ahnak APN 19 9013730 nonsense probably null
IGL00807:Ahnak APN 19 9008522 missense possibly damaging 0.92
IGL00870:Ahnak APN 19 9013698 missense probably damaging 1.00
IGL01101:Ahnak APN 19 9012887 intron probably benign
IGL01118:Ahnak APN 19 9012578 missense probably damaging 1.00
IGL01288:Ahnak APN 19 9002494 missense possibly damaging 0.94
IGL01324:Ahnak APN 19 9003032 missense probably damaging 1.00
IGL01341:Ahnak APN 19 9011703 missense probably benign
IGL01541:Ahnak APN 19 9007879 missense possibly damaging 0.95
IGL01580:Ahnak APN 19 9002839 missense probably benign 0.02
IGL01595:Ahnak APN 19 9003501 nonsense probably null
IGL01746:Ahnak APN 19 9004912 missense possibly damaging 0.89
IGL01766:Ahnak APN 19 9000118 missense unknown
IGL01821:Ahnak APN 19 9012118 missense probably benign
IGL01913:Ahnak APN 19 9006064 nonsense probably null
IGL01934:Ahnak APN 19 9002657 missense probably damaging 1.00
IGL01940:Ahnak APN 19 9006557 missense probably benign 0.14
IGL01958:Ahnak APN 19 9014909 missense possibly damaging 0.59
IGL02145:Ahnak APN 19 9002855 missense probably benign 0.11
IGL02246:Ahnak APN 19 9008268 missense probably damaging 1.00
IGL02282:Ahnak APN 19 9005987 missense probably damaging 1.00
IGL02428:Ahnak APN 19 9014833 missense possibly damaging 0.83
IGL02442:Ahnak APN 19 9004016 missense probably damaging 1.00
IGL02474:Ahnak APN 19 9004933 missense probably benign 0.13
IGL02483:Ahnak APN 19 9003308 missense probably benign 0.01
IGL02616:Ahnak APN 19 9005627 missense probably benign 0.03
IGL02630:Ahnak APN 19 9012077 missense probably damaging 1.00
IGL02690:Ahnak APN 19 9012584 nonsense probably null
IGL02717:Ahnak APN 19 9002387 missense probably benign 0.00
IGL02721:Ahnak APN 19 9009707 missense probably benign 0.07
IGL02737:Ahnak APN 19 9004593 missense probably benign 0.17
IGL02850:Ahnak APN 19 9002596 missense probably benign 0.00
IGL03071:Ahnak APN 19 9011918 missense possibly damaging 0.63
IGL03072:Ahnak APN 19 9006508 missense probably benign 0.11
IGL03094:Ahnak APN 19 9003547 missense possibly damaging 0.64
IGL03140:Ahnak APN 19 9005212 intron probably benign
IGL03176:Ahnak APN 19 9008166 missense possibly damaging 0.56
IGL03176:Ahnak APN 19 9002449 missense probably damaging 1.00
IGL03189:Ahnak APN 19 9011239 missense possibly damaging 0.65
IGL03357:Ahnak APN 19 9009325 intron probably benign
IGL03371:Ahnak APN 19 9004228 missense possibly damaging 0.91
Eskimo UTSW 19 9009574 missense probably benign 0.31
IGL03097:Ahnak UTSW 19 9002387 missense probably benign 0.00
R0054:Ahnak UTSW 19 9012056 missense probably damaging 1.00
R0094:Ahnak UTSW 19 9013893 missense probably benign 0.12
R0110:Ahnak UTSW 19 9018232 nonsense probably null
R0141:Ahnak UTSW 19 9006680 missense probably damaging 1.00
R0166:Ahnak UTSW 19 9005725 missense probably damaging 1.00
R0309:Ahnak UTSW 19 9002495 missense probably damaging 1.00
R0368:Ahnak UTSW 19 9008350 nonsense probably null
R0386:Ahnak UTSW 19 9011144 missense possibly damaging 0.94
R0401:Ahnak UTSW 19 9015116 missense probably benign 0.24
R0415:Ahnak UTSW 19 9012871 intron probably benign
R0463:Ahnak UTSW 19 9009407 intron probably benign
R0469:Ahnak UTSW 19 9018232 nonsense probably null
R0470:Ahnak UTSW 19 9008967 missense probably benign 0.29
R0487:Ahnak UTSW 19 9007151 missense probably benign 0.00
R0487:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R0499:Ahnak UTSW 19 9000264 splice site probably benign
R0506:Ahnak UTSW 19 9009128 missense probably damaging 1.00
R0510:Ahnak UTSW 19 9018232 nonsense probably null
R0557:Ahnak UTSW 19 9001944 missense probably benign 0.10
R0570:Ahnak UTSW 19 9013698 missense probably damaging 1.00
R0610:Ahnak UTSW 19 9007878 missense probably benign 0.08
R0646:Ahnak UTSW 19 9013402 nonsense probably null
R0659:Ahnak UTSW 19 9015002 missense possibly damaging 0.60
R0791:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0792:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0840:Ahnak UTSW 19 9005063 missense probably damaging 1.00
R0847:Ahnak UTSW 19 9006433 nonsense probably null
R0941:Ahnak UTSW 19 9009914 missense probably damaging 1.00
R0962:Ahnak UTSW 19 9012848 intron probably benign
R1017:Ahnak UTSW 19 9010543 missense probably damaging 0.99
R1037:Ahnak UTSW 19 9007618 missense probably benign 0.27
R1085:Ahnak UTSW 19 9013125 missense possibly damaging 0.50
R1113:Ahnak UTSW 19 9005620 missense probably benign 0.29
R1140:Ahnak UTSW 19 9004245 missense probably damaging 1.00
R1158:Ahnak UTSW 19 9013926 missense probably benign 0.00
R1218:Ahnak UTSW 19 9015619 missense probably damaging 1.00
R1225:Ahnak UTSW 19 9002883 missense probably damaging 1.00
R1245:Ahnak UTSW 19 9004169 missense probably benign 0.44
R1421:Ahnak UTSW 19 9015631 missense possibly damaging 0.95
R1447:Ahnak UTSW 19 9007082 missense probably damaging 0.98
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1471:Ahnak UTSW 19 9012932 intron probably benign
R1507:Ahnak UTSW 19 9010077 missense probably damaging 1.00
R1521:Ahnak UTSW 19 9004728 missense probably benign 0.11
R1568:Ahnak UTSW 19 9002375 missense probably damaging 0.98
R1569:Ahnak UTSW 19 9004094 missense possibly damaging 0.78
R1616:Ahnak UTSW 19 9008987 missense possibly damaging 0.94
R1638:Ahnak UTSW 19 9009449 missense probably benign 0.01
R1680:Ahnak UTSW 19 9009963 missense probably benign 0.05
R1713:Ahnak UTSW 19 9011809 missense possibly damaging 0.95
R1722:Ahnak UTSW 19 9010655 missense probably damaging 0.99
R1771:Ahnak UTSW 19 9013753 missense probably benign 0.24
R1795:Ahnak UTSW 19 9002438 missense possibly damaging 0.79
R1823:Ahnak UTSW 19 9004905 missense probably damaging 0.99
R1842:Ahnak UTSW 19 9005867 missense probably damaging 0.99
R1854:Ahnak UTSW 19 9013832 missense possibly damaging 0.61
R1856:Ahnak UTSW 19 9002048 missense possibly damaging 0.86
R1886:Ahnak UTSW 19 9015979 missense probably damaging 0.98
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1912:Ahnak UTSW 19 9017881 missense probably damaging 1.00
R1913:Ahnak UTSW 19 9007922 missense probably damaging 0.99
R1942:Ahnak UTSW 19 9015083 missense probably damaging 0.98
R1987:Ahnak UTSW 19 9015251 missense probably damaging 1.00
R2006:Ahnak UTSW 19 9007075 missense probably damaging 1.00
R2013:Ahnak UTSW 19 9014573 missense probably damaging 0.98
R2014:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R2047:Ahnak UTSW 19 9014300 missense possibly damaging 0.67
R2048:Ahnak UTSW 19 9007056 missense probably damaging 0.99
R2060:Ahnak UTSW 19 9008041 missense probably benign 0.08
R2083:Ahnak UTSW 19 9011557 missense probably damaging 1.00
R2157:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R2167:Ahnak UTSW 19 9011494 nonsense probably null
R2208:Ahnak UTSW 19 9017732 missense probably benign 0.00
R2224:Ahnak UTSW 19 9012991 intron probably benign
R2268:Ahnak UTSW 19 9010574 missense possibly damaging 0.66
R2420:Ahnak UTSW 19 9009256 missense possibly damaging 0.89
R2426:Ahnak UTSW 19 9002851 missense possibly damaging 0.81
R2910:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2911:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2981:Ahnak UTSW 19 9000148 missense probably damaging 0.97
R3151:Ahnak UTSW 19 9009944 missense probably benign 0.12
R3155:Ahnak UTSW 19 9010177 missense possibly damaging 0.49
R3422:Ahnak UTSW 19 9005708 missense probably benign 0.39
R3422:Ahnak UTSW 19 9006752 missense probably benign 0.05
R3430:Ahnak UTSW 19 9006958 missense probably benign 0.42
R3433:Ahnak UTSW 19 9009994 missense probably benign 0.01
R3711:Ahnak UTSW 19 9007898 missense probably benign
R3723:Ahnak UTSW 19 9016853 missense possibly damaging 0.79
R3775:Ahnak UTSW 19 9009023 missense possibly damaging 0.91
R3858:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3859:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3922:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3924:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3926:Ahnak UTSW 19 9006328 missense probably benign 0.20
R4026:Ahnak UTSW 19 9011299 missense probably damaging 0.97
R4051:Ahnak UTSW 19 9014327 missense probably damaging 1.00
R4209:Ahnak UTSW 19 9002600 missense probably damaging 1.00
R4234:Ahnak UTSW 19 9000786 nonsense probably null
R4237:Ahnak UTSW 19 9001783 missense probably benign 0.02
R4285:Ahnak UTSW 19 9016839 nonsense probably null
R4331:Ahnak UTSW 19 9015820 missense probably damaging 1.00
R4342:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R4430:Ahnak UTSW 19 9003040 missense probably benign 0.00
R4554:Ahnak UTSW 19 9014930 missense probably damaging 1.00
R4602:Ahnak UTSW 19 9010825 missense possibly damaging 0.66
R4612:Ahnak UTSW 19 9003724 missense probably benign 0.44
R4655:Ahnak UTSW 19 9008701 missense probably damaging 1.00
R4656:Ahnak UTSW 19 9004855 missense possibly damaging 0.80
R4700:Ahnak UTSW 19 9004681 missense probably benign 0.02
R4704:Ahnak UTSW 19 9012258 intron probably benign
R4704:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R4705:Ahnak UTSW 19 9016906 missense probably benign 0.07
R4707:Ahnak UTSW 19 9016735 missense probably benign 0.03
R4732:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4733:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4778:Ahnak UTSW 19 9011975 missense possibly damaging 0.79
R4782:Ahnak UTSW 19 9012499 intron probably benign
R4832:Ahnak UTSW 19 9012460 intron probably benign
R4882:Ahnak UTSW 19 9005897 missense probably damaging 0.98
R4884:Ahnak UTSW 19 9012754 intron probably benign
R4895:Ahnak UTSW 19 9017441 missense probably benign 0.43
R4930:Ahnak UTSW 19 9010967 missense possibly damaging 0.79
R4951:Ahnak UTSW 19 9017835 missense probably damaging 1.00
R4968:Ahnak UTSW 19 9015100 missense probably damaging 1.00
R5026:Ahnak UTSW 19 9010631 missense possibly damaging 0.46
R5050:Ahnak UTSW 19 9012458 intron probably benign
R5073:Ahnak UTSW 19 9003231 missense probably benign 0.42
R5110:Ahnak UTSW 19 9014759 missense probably damaging 1.00
R5119:Ahnak UTSW 19 9013644 missense probably benign 0.00
R5128:Ahnak UTSW 19 9017087 missense probably damaging 1.00
R5139:Ahnak UTSW 19 9004655 missense probably damaging 1.00
R5150:Ahnak UTSW 19 9010904 missense possibly damaging 0.46
R5151:Ahnak UTSW 19 9017569 missense probably benign 0.03
R5165:Ahnak UTSW 19 9015665 missense possibly damaging 0.95
R5236:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R5361:Ahnak UTSW 19 9015341 missense possibly damaging 0.92
R5366:Ahnak UTSW 19 9016735 missense possibly damaging 0.65
R5387:Ahnak UTSW 19 9003691 missense probably damaging 1.00
R5396:Ahnak UTSW 19 9007175 missense probably damaging 0.99
R5583:Ahnak UTSW 19 9006917 missense probably damaging 0.99
R5587:Ahnak UTSW 19 9009476 missense possibly damaging 0.88
R5620:Ahnak UTSW 19 9013094 nonsense probably null
R5643:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5657:Ahnak UTSW 19 9014615 missense probably damaging 0.99
R5688:Ahnak UTSW 19 9002519 missense probably benign 0.01
R5702:Ahnak UTSW 19 9001840 missense probably damaging 1.00
R5727:Ahnak UTSW 19 9016747 missense probably damaging 0.99
R5730:Ahnak UTSW 19 9010253 missense possibly damaging 0.81
R5755:Ahnak UTSW 19 9001732 missense probably benign 0.06
R5760:Ahnak UTSW 19 9013562 missense probably damaging 1.00
R5789:Ahnak UTSW 19 9002321 missense probably benign 0.00
R5790:Ahnak UTSW 19 9015248 missense probably damaging 0.99
R5795:Ahnak UTSW 19 9012382 nonsense probably null
R5808:Ahnak UTSW 19 9010235 missense possibly damaging 0.91
R5867:Ahnak UTSW 19 9010052 missense probably damaging 0.99
R5878:Ahnak UTSW 19 9008342 missense probably damaging 1.00
R5898:Ahnak UTSW 19 9013767 missense possibly damaging 0.63
R5898:Ahnak UTSW 19 9018211 missense probably damaging 1.00
R5912:Ahnak UTSW 19 9011903 missense probably damaging 0.99
R5935:Ahnak UTSW 19 9015182 missense possibly damaging 0.91
R5969:Ahnak UTSW 19 9016585 missense probably damaging 1.00
R5988:Ahnak UTSW 19 9009347 intron probably benign
R6000:Ahnak UTSW 19 9013111 nonsense probably null
R6005:Ahnak UTSW 19 9015161 missense possibly damaging 0.61
R6101:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6105:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6116:Ahnak UTSW 19 9012963 intron probably benign
R6209:Ahnak UTSW 19 9012566 missense probably damaging 1.00
R6240:Ahnak UTSW 19 9013583 missense probably damaging 1.00
R6255:Ahnak UTSW 19 9008025 missense possibly damaging 0.95
R6263:Ahnak UTSW 19 9018277 missense probably benign 0.03
R6287:Ahnak UTSW 19 9015003 missense probably benign 0.02
R6296:Ahnak UTSW 19 9003305 missense probably damaging 0.99
R6315:Ahnak UTSW 19 9006626 missense probably damaging 0.99
R6328:Ahnak UTSW 19 9007148 missense probably benign 0.11
R6331:Ahnak UTSW 19 9006625 missense probably benign 0.18
R6355:Ahnak UTSW 19 9008762 missense probably benign 0.02
R6409:Ahnak UTSW 19 9009574 missense probably benign 0.31
R6567:Ahnak UTSW 19 9008806 missense probably benign 0.27
R6572:Ahnak UTSW 19 9007976 missense probably damaging 0.99
R6574:Ahnak UTSW 19 9017047 missense probably benign 0.04
R6593:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6620:Ahnak UTSW 19 9015310 missense possibly damaging 0.95
R6690:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6731:Ahnak UTSW 19 9011562 missense possibly damaging 0.85
R6756:Ahnak UTSW 19 9007561 missense possibly damaging 0.59
R6846:Ahnak UTSW 19 9011857 missense possibly damaging 0.66
R6854:Ahnak UTSW 19 9015235 missense probably damaging 1.00
R6857:Ahnak UTSW 19 9037168 nonsense probably null
R6863:Ahnak UTSW 19 9012365 intron probably benign
R6876:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R6958:Ahnak UTSW 19 9015215 missense possibly damaging 0.88
X0021:Ahnak UTSW 19 9013619 missense probably damaging 0.99
X0027:Ahnak UTSW 19 9012037 missense probably damaging 1.00
Z1088:Ahnak UTSW 19 9016082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCTGGACCCAAACTGGAG -3'
(R):5'- TCCACTTTGGGTCCTTTGAAG -3'

Sequencing Primer
(F):5'- CTGGAGGGTGACATTAAAGTTCCC -3'
(R):5'- AAATTTGGGCCTGCTGCATC -3'
Posted On2016-11-08