Incidental Mutation 'R5645:Treh'
ID441072
Institutional Source Beutler Lab
Gene Symbol Treh
Ensembl Gene ENSMUSG00000032098
Gene Nametrehalase (brush-border membrane glycoprotein)
Synonyms2210412M19Rik
MMRRC Submission 043293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5645 (G1)
Quality Score221
Status Not validated
Chromosome9
Chromosomal Location44673233-44686305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44682678 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 154 (Y154C)
Ref Sequence ENSEMBL: ENSMUSP00000034609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034609] [ENSMUST00000034611] [ENSMUST00000071219] [ENSMUST00000134465] [ENSMUST00000135436] [ENSMUST00000138356] [ENSMUST00000139389] [ENSMUST00000144251] [ENSMUST00000147495] [ENSMUST00000150822] [ENSMUST00000156918]
Predicted Effect probably damaging
Transcript: ENSMUST00000034609
AA Change: Y154C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034609
Gene: ENSMUSG00000032098
AA Change: Y154C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Trehalase 43 548 2.3e-185 PFAM
low complexity region 565 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034611
SMART Domains Protein: ENSMUSP00000034611
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5.01e-5 PROSPERO
internal_repeat_1 401 449 5.01e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1366 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071219
SMART Domains Protein: ENSMUSP00000071206
Gene: ENSMUSG00000032098

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Trehalase 134 513 7e-145 PFAM
low complexity region 530 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128326
SMART Domains Protein: ENSMUSP00000119966
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
coiled coil region 357 396 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 493 506 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 564 572 N/A INTRINSIC
coiled coil region 610 679 N/A INTRINSIC
PH 723 827 1.31e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129806
Predicted Effect probably benign
Transcript: ENSMUST00000134465
SMART Domains Protein: ENSMUSP00000117395
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 8e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 6.75e-5 PROSPERO
internal_repeat_1 401 449 6.75e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 929 950 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
coiled coil region 1103 1172 N/A INTRINSIC
PH 1215 1319 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135436
SMART Domains Protein: ENSMUSP00000120023
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
coiled coil region 274 343 N/A INTRINSIC
PH 386 490 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138356
SMART Domains Protein: ENSMUSP00000120208
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 4.93e-5 PROSPERO
internal_repeat_1 401 449 4.93e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 931 948 N/A INTRINSIC
low complexity region 999 1017 N/A INTRINSIC
low complexity region 1032 1053 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
low complexity region 1159 1167 N/A INTRINSIC
coiled coil region 1206 1286 N/A INTRINSIC
PH 1329 1444 6.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139389
SMART Domains Protein: ENSMUSP00000120671
Gene: ENSMUSG00000032098

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Trehalase 43 141 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144251
SMART Domains Protein: ENSMUSP00000114773
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
coiled coil region 146 174 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
coiled coil region 225 264 N/A INTRINSIC
low complexity region 289 310 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
low complexity region 416 424 N/A INTRINSIC
coiled coil region 463 532 N/A INTRINSIC
PH 575 679 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147495
SMART Domains Protein: ENSMUSP00000122661
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5e-5 PROSPERO
internal_repeat_1 401 449 5e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1377 6.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148344
SMART Domains Protein: ENSMUSP00000121809
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
internal_repeat_1 66 99 6.7e-6 PROSPERO
internal_repeat_1 146 194 6.7e-6 PROSPERO
low complexity region 204 222 N/A INTRINSIC
low complexity region 335 362 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
coiled coil region 459 542 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
coiled coil region 609 648 N/A INTRINSIC
low complexity region 688 706 N/A INTRINSIC
low complexity region 721 742 N/A INTRINSIC
low complexity region 792 805 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 863 871 N/A INTRINSIC
coiled coil region 909 978 N/A INTRINSIC
PH 1022 1126 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150822
SMART Domains Protein: ENSMUSP00000123144
Gene: ENSMUSG00000032098

DomainStartEndE-ValueType
Pfam:Trehalase 1 121 3.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156918
SMART Domains Protein: ENSMUSP00000120092
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
low complexity region 136 146 N/A INTRINSIC
coiled coil region 182 221 N/A INTRINSIC
low complexity region 246 267 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
low complexity region 373 381 N/A INTRINSIC
coiled coil region 420 489 N/A INTRINSIC
PH 532 636 1.31e-17 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the alpha-glucosidase family, whose members encode enzymes that carry out hydrolysis of alpha-glucoside bonds of a variety of carbohydrates. The enzyme encoded by this gene uses the disaccharide trehalose as a highly specific substrate and converts it into two glucose molecules. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit a rapid increase in blood glucose levels following oral trehalose administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Agbl4 A T 4: 111,657,330 I513F possibly damaging Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap1 T C 11: 88,845,627 T103A probably benign Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cep295 A T 9: 15,332,794 H1455Q probably damaging Het
Cep295 C A 9: 15,335,108 S684I possibly damaging Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cul5 T C 9: 53,622,943 I630V probably benign Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam161a T A 11: 23,015,725 I6N probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Grin2a T A 16: 9,992,226 D103V probably damaging Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqcc A T 4: 129,616,527 H398Q possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr1233 A T 2: 89,339,705 V199E possibly damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Ywhae T C 11: 75,756,924 M160T probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Treh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Treh APN 9 44683900 missense probably damaging 1.00
IGL00984:Treh APN 9 44682967 unclassified probably benign
IGL02111:Treh APN 9 44682961 missense probably benign 0.02
IGL02493:Treh APN 9 44682949 missense possibly damaging 0.92
IGL03242:Treh APN 9 44685337 missense possibly damaging 0.51
IGL03392:Treh APN 9 44685931 missense probably damaging 0.96
R0041:Treh UTSW 9 44683613 missense probably benign 0.27
R1391:Treh UTSW 9 44685305 missense probably benign 0.02
R2099:Treh UTSW 9 44684646 missense probably damaging 1.00
R2142:Treh UTSW 9 44681141 missense probably damaging 1.00
R3936:Treh UTSW 9 44684543 missense probably benign 0.02
R4577:Treh UTSW 9 44685911 missense probably benign 0.11
R4715:Treh UTSW 9 44683318 missense probably benign 0.44
R4735:Treh UTSW 9 44681552 missense probably damaging 1.00
R4964:Treh UTSW 9 44682648 missense probably damaging 0.99
R5028:Treh UTSW 9 44682889 missense probably null 0.96
R5214:Treh UTSW 9 44682876 missense probably damaging 1.00
R7311:Treh UTSW 9 44685948 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGCACACCACCCAGTTG -3'
(R):5'- TCATCAGCTAGCTTGCACC -3'

Sequencing Primer
(F):5'- ACCCAGTTGAGCCAGGAG -3'
(R):5'- AGCTAGCTTGCACCCTCTG -3'
Posted On2016-11-08