Incidental Mutation 'R5645:Ywhae'
ID441085
Institutional Source Beutler Lab
Gene Symbol Ywhae
Ensembl Gene ENSMUSG00000020849
Gene Nametyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
Synonyms14-3-3 epsilon
MMRRC Submission 043293-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5645 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75732869-75765845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75756924 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 160 (M160T)
Ref Sequence ENSEMBL: ENSMUSP00000070993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067664] [ENSMUST00000134745]
Predicted Effect probably benign
Transcript: ENSMUST00000067664
AA Change: M160T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070993
Gene: ENSMUSG00000020849
AA Change: M160T

DomainStartEndE-ValueType
14_3_3 4 245 2.51e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131398
SMART Domains Protein: ENSMUSP00000123504
Gene: ENSMUSG00000020849

DomainStartEndE-ValueType
14_3_3 29 154 2.77e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134745
SMART Domains Protein: ENSMUSP00000117877
Gene: ENSMUSG00000020849

DomainStartEndE-ValueType
14_3_3 4 129 1.32e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181056
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. It interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. Two transcript variants, one protein-coding and the other non-protein-coding, have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene usually die around birth. The small percentage of survivors are small in size and display central nervous system abnormalities including a thinner cortex and a disorganized pyramidal cell layer in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Agbl4 A T 4: 111,657,330 I513F possibly damaging Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap1 T C 11: 88,845,627 T103A probably benign Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cep295 A T 9: 15,332,794 H1455Q probably damaging Het
Cep295 C A 9: 15,335,108 S684I possibly damaging Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cul5 T C 9: 53,622,943 I630V probably benign Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam161a T A 11: 23,015,725 I6N probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Grin2a T A 16: 9,992,226 D103V probably damaging Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqcc A T 4: 129,616,527 H398Q possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr1233 A T 2: 89,339,705 V199E possibly damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Treh A G 9: 44,682,678 Y154C probably damaging Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Ywhae
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0864:Ywhae UTSW 11 75759430 critical splice donor site probably null
R1766:Ywhae UTSW 11 75755665 missense probably damaging 1.00
R2075:Ywhae UTSW 11 75764660 missense probably benign 0.00
R7390:Ywhae UTSW 11 75764661 nonsense probably null
R7422:Ywhae UTSW 11 75759343 missense probably damaging 0.96
X0025:Ywhae UTSW 11 75755605 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAGAAAATTTCCATGCTGTAAGGAC -3'
(R):5'- TCTAGTACCAAGACCCTGCC -3'

Sequencing Primer
(F):5'- CCATGCTGTAAGGACTATTTTCTAAC -3'
(R):5'- GTTAAGAGAATCCTGTGACAACC -3'
Posted On2016-11-08