Incidental Mutation 'R5645:Akap1'
ID441086
Institutional Source Beutler Lab
Gene Symbol Akap1
Ensembl Gene ENSMUSG00000018428
Gene NameA kinase (PRKA) anchor protein 1
SynonymsDAKAP1, AKAP84, S-AKAP84, AKAP121
MMRRC Submission 043293-MU
Accession Numbers

Ncbi RefSeq: NM_001042541.1, NM_009648.2; MGI:104729

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5645 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location88830792-88864586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88845627 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 103 (T103A)
Ref Sequence ENSEMBL: ENSMUSP00000103537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018572] [ENSMUST00000107903] [ENSMUST00000107904] [ENSMUST00000143720]
Predicted Effect probably benign
Transcript: ENSMUST00000018572
AA Change: T70A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018572
Gene: ENSMUSG00000018428
AA Change: T70A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 449 462 N/A INTRINSIC
KH 560 630 1.59e-10 SMART
low complexity region 639 651 N/A INTRINSIC
TUDOR 710 769 5.32e-12 SMART
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107903
AA Change: T70A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103536
Gene: ENSMUSG00000018428
AA Change: T70A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 449 462 N/A INTRINSIC
KH 560 630 1.59e-10 SMART
low complexity region 639 651 N/A INTRINSIC
TUDOR 710 769 5.32e-12 SMART
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107904
AA Change: T103A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000103537
Gene: ENSMUSG00000018428
AA Change: T103A

DomainStartEndE-ValueType
transmembrane domain 40 59 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 482 495 N/A INTRINSIC
KH 593 663 1.59e-10 SMART
low complexity region 672 684 N/A INTRINSIC
TUDOR 743 802 5.32e-12 SMART
low complexity region 811 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143720
AA Change: T70A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122295
Gene: ENSMUSG00000018428
AA Change: T70A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:RII_binding_1 305 322 5.5e-5 PFAM
low complexity region 449 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153787
SMART Domains Protein: ENSMUSP00000123018
Gene: ENSMUSG00000018428

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153961
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype Strain: 3620561
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors them to the mitochondrion. This protein is speculated to be involved in the cAMP-dependent signal transduction pathway and in directing RNA to a specific cellular compartment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit reduced female fertility and impaired oocyte maturation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(3) Gene trapped(46)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Agbl4 A T 4: 111,657,330 I513F possibly damaging Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cep295 A T 9: 15,332,794 H1455Q probably damaging Het
Cep295 C A 9: 15,335,108 S684I possibly damaging Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cul5 T C 9: 53,622,943 I630V probably benign Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam161a T A 11: 23,015,725 I6N probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Grin2a T A 16: 9,992,226 D103V probably damaging Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqcc A T 4: 129,616,527 H398Q possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr1233 A T 2: 89,339,705 V199E possibly damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Treh A G 9: 44,682,678 Y154C probably damaging Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Ywhae T C 11: 75,756,924 M160T probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Akap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Akap1 APN 11 88844254 splice site probably null
IGL01333:Akap1 APN 11 88845605 missense probably damaging 0.99
IGL01701:Akap1 APN 11 88845132 missense probably benign 0.03
IGL01920:Akap1 APN 11 88839633 missense probably damaging 1.00
IGL02980:Akap1 UTSW 11 88845164 missense probably benign
PIT4305001:Akap1 UTSW 11 88844378 missense probably benign
R0049:Akap1 UTSW 11 88839624 critical splice donor site probably null
R0049:Akap1 UTSW 11 88839624 critical splice donor site probably null
R0278:Akap1 UTSW 11 88845194 missense probably benign 0.19
R1437:Akap1 UTSW 11 88844751 nonsense probably null
R1438:Akap1 UTSW 11 88844751 nonsense probably null
R1439:Akap1 UTSW 11 88844751 nonsense probably null
R1569:Akap1 UTSW 11 88833180 missense probably benign 0.02
R1611:Akap1 UTSW 11 88845278 missense probably benign 0.27
R1757:Akap1 UTSW 11 88845752 missense probably damaging 1.00
R2328:Akap1 UTSW 11 88845044 missense possibly damaging 0.46
R2897:Akap1 UTSW 11 88844779 nonsense probably null
R3730:Akap1 UTSW 11 88845182 missense possibly damaging 0.82
R4868:Akap1 UTSW 11 88844553 missense possibly damaging 0.83
R5620:Akap1 UTSW 11 88845517 missense possibly damaging 0.82
R5886:Akap1 UTSW 11 88834660 critical splice donor site probably null
R5932:Akap1 UTSW 11 88831759 missense probably damaging 1.00
R6284:Akap1 UTSW 11 88844568 missense possibly damaging 0.66
R6555:Akap1 UTSW 11 88844882 missense probably damaging 1.00
R7234:Akap1 UTSW 11 88838982 missense probably damaging 1.00
R7436:Akap1 UTSW 11 88845528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGTTCCACTTTGGCGATC -3'
(R):5'- CTGACTCCAAGATGGCAATCC -3'

Sequencing Primer
(F):5'- GCGATCTCATCTCTGCACGG -3'
(R):5'- CAATCCAGTTGCGTTCGC -3'
Posted On2016-11-08