Incidental Mutation 'R5645:Grin2a'
ID441101
Institutional Source Beutler Lab
Gene Symbol Grin2a
Ensembl Gene ENSMUSG00000059003
Gene Nameglutamate receptor, ionotropic, NMDA2A (epsilon 1)
SynonymsNR2A, GluRepsilon1, NMDAR2A, GluN2A
MMRRC Submission 043293-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R5645 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location9567898-9995560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9992226 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 103 (D103V)
Ref Sequence ENSEMBL: ENSMUSP00000142900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]
Predicted Effect probably damaging
Transcript: ENSMUST00000032331
AA Change: D103V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: D103V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115835
AA Change: D103V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: D103V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 99 300 9.2e-11 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 1.2e-266 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197242
Predicted Effect probably damaging
Transcript: ENSMUST00000199708
AA Change: D103V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: D103V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Agbl4 A T 4: 111,657,330 I513F possibly damaging Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap1 T C 11: 88,845,627 T103A probably benign Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cep295 A T 9: 15,332,794 H1455Q probably damaging Het
Cep295 C A 9: 15,335,108 S684I possibly damaging Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cul5 T C 9: 53,622,943 I630V probably benign Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam161a T A 11: 23,015,725 I6N probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqcc A T 4: 129,616,527 H398Q possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr1233 A T 2: 89,339,705 V199E possibly damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Treh A G 9: 44,682,678 Y154C probably damaging Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Ywhae T C 11: 75,756,924 M160T probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Grin2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Grin2a APN 16 9644130 missense probably benign 0.29
IGL03288:Grin2a APN 16 9669840 missense possibly damaging 0.85
IGL02796:Grin2a UTSW 16 9585108 missense possibly damaging 0.72
PIT4402001:Grin2a UTSW 16 9644199 missense possibly damaging 0.77
PIT4494001:Grin2a UTSW 16 9585096 missense probably damaging 0.98
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0211:Grin2a UTSW 16 9579173 missense possibly damaging 0.86
R0390:Grin2a UTSW 16 9579585 missense possibly damaging 0.85
R0659:Grin2a UTSW 16 9992472 missense probably damaging 0.98
R0661:Grin2a UTSW 16 9992472 missense probably damaging 0.98
R0734:Grin2a UTSW 16 9579611 missense possibly damaging 0.71
R1524:Grin2a UTSW 16 9663603 missense possibly damaging 0.55
R1542:Grin2a UTSW 16 9579203 missense probably damaging 0.98
R1556:Grin2a UTSW 16 9707715 missense probably benign 0.18
R1605:Grin2a UTSW 16 9663330 missense possibly damaging 0.46
R1792:Grin2a UTSW 16 9992395 missense possibly damaging 0.53
R2024:Grin2a UTSW 16 9644243 missense possibly damaging 0.76
R2057:Grin2a UTSW 16 9669744 missense probably benign 0.14
R2344:Grin2a UTSW 16 9663235 missense probably benign 0.03
R2847:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2848:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2981:Grin2a UTSW 16 9644223 missense possibly damaging 0.89
R4197:Grin2a UTSW 16 9761967 missense probably damaging 1.00
R4342:Grin2a UTSW 16 9653589 missense possibly damaging 0.52
R4741:Grin2a UTSW 16 9663512 missense probably damaging 1.00
R4891:Grin2a UTSW 16 9657706 missense possibly damaging 0.51
R4925:Grin2a UTSW 16 9669823 missense probably damaging 0.98
R5563:Grin2a UTSW 16 9707717 missense probably benign 0.18
R5769:Grin2a UTSW 16 9761526 missense possibly damaging 0.89
R5885:Grin2a UTSW 16 9761905 missense possibly damaging 0.95
R6065:Grin2a UTSW 16 9761907 missense possibly damaging 0.92
R6083:Grin2a UTSW 16 9579540 missense probably benign 0.02
R6137:Grin2a UTSW 16 9653449 missense probably benign 0.32
R6286:Grin2a UTSW 16 9761775 missense possibly damaging 0.93
R6342:Grin2a UTSW 16 9579334 missense probably damaging 0.98
R6697:Grin2a UTSW 16 9669840 missense possibly damaging 0.85
R6924:Grin2a UTSW 16 9663228 missense possibly damaging 0.71
R7070:Grin2a UTSW 16 9579424 missense possibly damaging 0.92
R7235:Grin2a UTSW 16 9579265 missense probably damaging 0.98
R7274:Grin2a UTSW 16 9579122 missense possibly damaging 0.71
X0024:Grin2a UTSW 16 9663199 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ATAGGAGATGTACCCCACCC -3'
(R):5'- ACTCCAGCGCTGAACATTGC -3'

Sequencing Primer
(F):5'- GATGTACCCCACCCCACCC -3'
(R):5'- CTGAACATTGCGGTGCTGC -3'
Posted On2016-11-08