Incidental Mutation 'R5646:Add1'
ID441138
Institutional Source Beutler Lab
Gene Symbol Add1
Ensembl Gene ENSMUSG00000029106
Gene Nameadducin 1 (alpha)
Synonyms
MMRRC Submission 043294-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R5646 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34573664-34632308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34630680 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 691 (A691D)
Ref Sequence ENSEMBL: ENSMUSP00000109979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000001109] [ENSMUST00000052836] [ENSMUST00000114329] [ENSMUST00000114331] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000126257] [ENSMUST00000134156] [ENSMUST00000137150] [ENSMUST00000137506] [ENSMUST00000149657] [ENSMUST00000155577] [ENSMUST00000201147] [ENSMUST00000201810] [ENSMUST00000202378]
Predicted Effect probably benign
Transcript: ENSMUST00000001108
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001109
SMART Domains Protein: ENSMUSP00000001109
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.9e-41 PFAM
Pfam:Sugar_tr 62 235 7.9e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052836
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114329
SMART Domains Protein: ENSMUSP00000109968
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114331
SMART Domains Protein: ENSMUSP00000109970
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114335
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114338
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114340
AA Change: A691D

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106
AA Change: A691D

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126257
SMART Domains Protein: ENSMUSP00000144630
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 139 5.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130347
Predicted Effect probably benign
Transcript: ENSMUST00000134156
SMART Domains Protein: ENSMUSP00000143812
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136010
Predicted Effect probably benign
Transcript: ENSMUST00000137150
SMART Domains Protein: ENSMUSP00000120814
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137262
Predicted Effect probably benign
Transcript: ENSMUST00000137506
SMART Domains Protein: ENSMUSP00000144121
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 31 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148270
Predicted Effect probably benign
Transcript: ENSMUST00000149657
SMART Domains Protein: ENSMUSP00000118786
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 261 1.3e-26 PFAM
Pfam:Sugar_tr 71 228 9.3e-10 PFAM
Pfam:TRI12 76 232 3.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151247
Predicted Effect probably benign
Transcript: ENSMUST00000152805
SMART Domains Protein: ENSMUSP00000121402
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 95 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155577
SMART Domains Protein: ENSMUSP00000115204
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 269 1.1e-27 PFAM
Pfam:Sugar_tr 71 228 9.6e-10 PFAM
Pfam:TRI12 76 232 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200717
Predicted Effect probably benign
Transcript: ENSMUST00000201147
SMART Domains Protein: ENSMUSP00000144239
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
low complexity region 80 95 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201810
SMART Domains Protein: ENSMUSP00000144673
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 142 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202065
Predicted Effect probably benign
Transcript: ENSMUST00000202378
SMART Domains Protein: ENSMUSP00000144117
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 24 43 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted gene deletion leads to reduced growth and compensated hemolytic anemia. RBCs are osmotically fragile, dehydrated, and spherocytic with severe loss of membrane surface area and reduced MCV. ~50% of homozygotes develop lethal hydrocephaly with dilation of the lateral, 3rd, and 4th ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,776 S4467P probably damaging Het
Agap3 C A 5: 24,483,397 D394E probably benign Het
Arhgef11 T C 3: 87,684,486 V59A possibly damaging Het
Atp2a1 A G 7: 126,453,105 V402A probably benign Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Bsn A T 9: 108,110,432 probably benign Het
Camk1 A G 6: 113,339,340 V81A probably damaging Het
Cass4 T G 2: 172,416,245 C54W probably damaging Het
Ccdc39 A T 3: 33,825,550 F456L probably damaging Het
Cdc42bpa A G 1: 180,106,094 E766G probably damaging Het
Cdcp2 T C 4: 107,105,142 C171R probably damaging Het
Cdh9 G A 15: 16,823,285 E118K probably damaging Het
Col4a2 G A 8: 11,441,281 G1227R probably damaging Het
Cyp2d9 A G 15: 82,452,464 T5A probably benign Het
Dlg5 T A 14: 24,158,699 D813V probably damaging Het
Dmtf1 G A 5: 9,124,515 S405F possibly damaging Het
Drd2 A G 9: 49,404,912 K324R probably benign Het
Ergic1 T C 17: 26,614,358 S29P probably damaging Het
Fmnl1 A G 11: 103,196,512 probably benign Het
Foxd2 C T 4: 114,908,635 A63T unknown Het
Gfap T C 11: 102,891,456 I409M probably benign Het
Gfpt1 A G 6: 87,042,999 M1V probably null Het
H2-T23 C G 17: 36,031,803 E148Q possibly damaging Het
Hip1 G A 5: 135,428,741 R704W probably damaging Het
Kif19a A C 11: 114,779,654 D130A probably damaging Het
Lin7b T C 7: 45,369,193 D14G probably damaging Het
Meioc T A 11: 102,675,257 N510K possibly damaging Het
Mettl5 C A 2: 69,881,319 G68* probably null Het
Mitf A T 6: 98,013,694 I184F probably damaging Het
Mmp9 T A 2: 164,949,050 H119Q probably benign Het
Mycbp2 T A 14: 103,169,910 H2768L probably benign Het
Myh2 A T 11: 67,188,812 I1032F probably benign Het
Myo3b T C 2: 70,314,430 I1110T probably damaging Het
Nde1 T C 16: 14,169,514 F8L probably damaging Het
Olfr1317 T C 2: 112,142,683 V246A possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr432 C T 1: 174,051,287 Q305* probably null Het
Olfr447 A G 6: 42,911,523 probably null Het
Olfr550 A C 7: 102,579,305 Y270S possibly damaging Het
Olfr753-ps1 T C 17: 37,169,917 I244V probably benign Het
Olfr771 T C 10: 129,160,837 D49G possibly damaging Het
Pcdhga8 A G 18: 37,726,770 H293R probably benign Het
Pde7a A T 3: 19,233,773 L244Q probably damaging Het
Pex14 T C 4: 148,961,453 D340G probably benign Het
Pfkfb4 A T 9: 109,008,421 I195F probably damaging Het
Pik3c2a C A 7: 116,405,951 G361W probably damaging Het
Prkcg T A 7: 3,329,081 M517K probably damaging Het
Prob1 A T 18: 35,654,114 F362L probably benign Het
Rims4 C T 2: 163,864,017 W232* probably null Het
Robo2 T C 16: 73,961,819 D688G probably damaging Het
Sec24c C A 14: 20,679,573 A73E probably benign Het
Slc15a3 A G 19: 10,843,210 N64D probably benign Het
Smg1 A T 7: 118,212,559 N65K probably benign Het
Sptb G T 12: 76,587,441 D2165E probably benign Het
Sptbn5 A T 2: 120,048,811 noncoding transcript Het
Syt12 A T 19: 4,456,541 M192K possibly damaging Het
Tas2r107 A G 6: 131,659,708 V126A probably benign Het
Thbs3 T C 3: 89,219,098 L242P probably damaging Het
Timp2 A T 11: 118,317,532 probably null Het
Tmtc1 G A 6: 148,246,831 A751V probably damaging Het
Tnni2 A T 7: 142,443,913 D85V probably damaging Het
Ttc39b G A 4: 83,244,070 P319L probably damaging Het
Ttc6 A T 12: 57,576,019 K68M probably damaging Het
Usp25 G A 16: 77,050,472 R156Q probably benign Het
Vill A T 9: 119,071,162 D365V probably damaging Het
Vmn1r65 T A 7: 6,009,224 T4S probably benign Het
Vmn2r76 C A 7: 86,226,053 C572F probably damaging Het
Vps26a A C 10: 62,468,298 N181K probably damaging Het
Xirp2 T C 2: 67,510,790 L1125P probably damaging Het
Zbtb41 T G 1: 139,423,763 S205A probably benign Het
Zfp438 T C 18: 5,214,526 D144G probably benign Het
Zfp600 T C 4: 146,195,100 S113P probably damaging Het
Zfp84 C T 7: 29,776,393 T170M probably benign Het
Zmiz2 T A 11: 6,402,837 D654E probably damaging Het
Zswim4 A T 8: 84,231,110 probably null Het
Other mutations in Add1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Add1 APN 5 34613358 missense probably damaging 1.00
IGL01370:Add1 APN 5 34630515 missense probably damaging 1.00
IGL01670:Add1 APN 5 34620063 missense probably damaging 1.00
IGL02965:Add1 APN 5 34620123 missense probably damaging 0.99
IGL03178:Add1 APN 5 34614245 unclassified probably null
R0126:Add1 UTSW 5 34613579 missense probably benign 0.04
R0189:Add1 UTSW 5 34616648 missense probably benign 0.01
R0195:Add1 UTSW 5 34610646 unclassified probably benign
R0318:Add1 UTSW 5 34625340 missense probably damaging 0.99
R0605:Add1 UTSW 5 34614224 missense possibly damaging 0.87
R0624:Add1 UTSW 5 34605853 missense probably damaging 1.00
R1514:Add1 UTSW 5 34610617 missense probably benign 0.03
R1573:Add1 UTSW 5 34601396 missense possibly damaging 0.89
R2512:Add1 UTSW 5 34616686 missense probably benign 0.02
R2965:Add1 UTSW 5 34630714 missense probably benign 0.00
R2966:Add1 UTSW 5 34630714 missense probably benign 0.00
R5993:Add1 UTSW 5 34601533 missense probably damaging 1.00
R6356:Add1 UTSW 5 34619396 missense probably null 1.00
R6514:Add1 UTSW 5 34605973 missense probably damaging 1.00
R6536:Add1 UTSW 5 34601436 missense possibly damaging 0.89
R6659:Add1 UTSW 5 34613295 missense possibly damaging 0.94
R7326:Add1 UTSW 5 34619371 missense probably benign 0.32
R7473:Add1 UTSW 5 34619353 missense possibly damaging 0.84
Z1088:Add1 UTSW 5 34613400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGATGCCACCACCTTCAAG -3'
(R):5'- TCCATTACACAGGAGGATAGAACAC -3'

Sequencing Primer
(F):5'- ACCTTCAAGCCGACGCC -3'
(R):5'- TGACAGAGCCAGGCCTGTAG -3'
Posted On2016-11-08