Incidental Mutation 'R5646:Robo2'
ID441189
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
MMRRC Submission 043294-MU
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R5646 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73961819 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 688 (D688G)
Ref Sequence ENSEMBL: ENSMUSP00000112776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]
Predicted Effect probably damaging
Transcript: ENSMUST00000116586
AA Change: D692G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: D692G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117200
AA Change: D688G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: D688G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117785
AA Change: D688G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: D688G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226478
AA Change: D692G

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000227347
AA Change: D692G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect unknown
Transcript: ENSMUST00000231889
AA Change: D14G
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,283,776 S4467P probably damaging Het
Add1 C A 5: 34,630,680 A691D probably benign Het
Agap3 C A 5: 24,483,397 D394E probably benign Het
Arhgef11 T C 3: 87,684,486 V59A possibly damaging Het
Atp2a1 A G 7: 126,453,105 V402A probably benign Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Bsn A T 9: 108,110,432 probably benign Het
Camk1 A G 6: 113,339,340 V81A probably damaging Het
Cass4 T G 2: 172,416,245 C54W probably damaging Het
Ccdc39 A T 3: 33,825,550 F456L probably damaging Het
Cdc42bpa A G 1: 180,106,094 E766G probably damaging Het
Cdcp2 T C 4: 107,105,142 C171R probably damaging Het
Cdh9 G A 15: 16,823,285 E118K probably damaging Het
Col4a2 G A 8: 11,441,281 G1227R probably damaging Het
Cyp2d9 A G 15: 82,452,464 T5A probably benign Het
Dlg5 T A 14: 24,158,699 D813V probably damaging Het
Dmtf1 G A 5: 9,124,515 S405F possibly damaging Het
Drd2 A G 9: 49,404,912 K324R probably benign Het
Ergic1 T C 17: 26,614,358 S29P probably damaging Het
Fmnl1 A G 11: 103,196,512 probably benign Het
Foxd2 C T 4: 114,908,635 A63T unknown Het
Gfap T C 11: 102,891,456 I409M probably benign Het
Gfpt1 A G 6: 87,042,999 M1V probably null Het
H2-T23 C G 17: 36,031,803 E148Q possibly damaging Het
Hip1 G A 5: 135,428,741 R704W probably damaging Het
Kif19a A C 11: 114,779,654 D130A probably damaging Het
Lin7b T C 7: 45,369,193 D14G probably damaging Het
Meioc T A 11: 102,675,257 N510K possibly damaging Het
Mettl5 C A 2: 69,881,319 G68* probably null Het
Mitf A T 6: 98,013,694 I184F probably damaging Het
Mmp9 T A 2: 164,949,050 H119Q probably benign Het
Mycbp2 T A 14: 103,169,910 H2768L probably benign Het
Myh2 A T 11: 67,188,812 I1032F probably benign Het
Myo3b T C 2: 70,314,430 I1110T probably damaging Het
Nde1 T C 16: 14,169,514 F8L probably damaging Het
Olfr1317 T C 2: 112,142,683 V246A possibly damaging Het
Olfr202 C T 16: 59,283,979 V173I probably benign Het
Olfr432 C T 1: 174,051,287 Q305* probably null Het
Olfr447 A G 6: 42,911,523 probably null Het
Olfr550 A C 7: 102,579,305 Y270S possibly damaging Het
Olfr753-ps1 T C 17: 37,169,917 I244V probably benign Het
Olfr771 T C 10: 129,160,837 D49G possibly damaging Het
Pcdhga8 A G 18: 37,726,770 H293R probably benign Het
Pde7a A T 3: 19,233,773 L244Q probably damaging Het
Pex14 T C 4: 148,961,453 D340G probably benign Het
Pfkfb4 A T 9: 109,008,421 I195F probably damaging Het
Pik3c2a C A 7: 116,405,951 G361W probably damaging Het
Prkcg T A 7: 3,329,081 M517K probably damaging Het
Prob1 A T 18: 35,654,114 F362L probably benign Het
Rims4 C T 2: 163,864,017 W232* probably null Het
Sec24c C A 14: 20,679,573 A73E probably benign Het
Slc15a3 A G 19: 10,843,210 N64D probably benign Het
Smg1 A T 7: 118,212,559 N65K probably benign Het
Sptb G T 12: 76,587,441 D2165E probably benign Het
Sptbn5 A T 2: 120,048,811 noncoding transcript Het
Syt12 A T 19: 4,456,541 M192K possibly damaging Het
Tas2r107 A G 6: 131,659,708 V126A probably benign Het
Thbs3 T C 3: 89,219,098 L242P probably damaging Het
Timp2 A T 11: 118,317,532 probably null Het
Tmtc1 G A 6: 148,246,831 A751V probably damaging Het
Tnni2 A T 7: 142,443,913 D85V probably damaging Het
Ttc39b G A 4: 83,244,070 P319L probably damaging Het
Ttc6 A T 12: 57,576,019 K68M probably damaging Het
Usp25 G A 16: 77,050,472 R156Q probably benign Het
Vill A T 9: 119,071,162 D365V probably damaging Het
Vmn1r65 T A 7: 6,009,224 T4S probably benign Het
Vmn2r76 C A 7: 86,226,053 C572F probably damaging Het
Vps26a A C 10: 62,468,298 N181K probably damaging Het
Xirp2 T C 2: 67,510,790 L1125P probably damaging Het
Zbtb41 T G 1: 139,423,763 S205A probably benign Het
Zfp438 T C 18: 5,214,526 D144G probably benign Het
Zfp600 T C 4: 146,195,100 S113P probably damaging Het
Zfp84 C T 7: 29,776,393 T170M probably benign Het
Zmiz2 T A 11: 6,402,837 D654E probably damaging Het
Zswim4 A T 8: 84,231,110 probably null Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAAAATTACACTCCTGGATTCAC -3'
(R):5'- CTCAGATGACCATGAAGAGGTC -3'

Sequencing Primer
(F):5'- CCATTCCTTGGAACTCGT -3'
(R):5'- TGACCATGAAGAGGTCAGAGAG -3'
Posted On2016-11-08