Incidental Mutation 'R5647:Pmp2'
ID441206
Institutional Source Beutler Lab
Gene Symbol Pmp2
Ensembl Gene ENSMUSG00000052468
Gene Nameperipheral myelin protein 2
SynonymsP2
MMRRC Submission 043295-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5647 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location10179851-10183929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10183785 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 12 (V12A)
Ref Sequence ENSEMBL: ENSMUSP00000029034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029034] [ENSMUST00000194885]
Predicted Effect probably benign
Transcript: ENSMUST00000029034
AA Change: V12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029034
Gene: ENSMUSG00000052468
AA Change: V12A

DomainStartEndE-ValueType
Pfam:Lipocalin 6 132 2.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194885
SMART Domains Protein: ENSMUSP00000141340
Gene: ENSMUSG00000103124

DomainStartEndE-ValueType
Pfam:Lipocalin 16 94 8.7e-14 PFAM
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to myelin sheaths of the peripheral nervous system. The encoded protein can bind both the membrane layers of the sheaths and monomeric lipids, and is thought to provide stability to the sheath. A defect in this gene was shown to be a cause of dominant demyelinating CMT neuropathy. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a temporary reduction in motor nerve conduction velocity and transitory alterations in the lipid profile of peripheral myelin but no major defects in general PNS myelin structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T C 7: 82,856,398 noncoding transcript Het
9330159F19Rik A T 10: 29,225,254 D541V probably damaging Het
9930021J03Rik A G 19: 29,753,810 S601P possibly damaging Het
Abcc5 T C 16: 20,399,847 I262V probably damaging Het
Acvr1c T A 2: 58,295,964 D169V probably damaging Het
Aldh16a1 A G 7: 45,154,465 V6A probably benign Het
Cd36 A C 5: 17,814,765 S113A probably damaging Het
Cdt1 G T 8: 122,570,208 R247L possibly damaging Het
Ces4a G A 8: 105,146,080 V322M probably benign Het
Cngb3 A T 4: 19,364,266 T157S possibly damaging Het
Cpped1 T C 16: 11,828,146 probably benign Het
Ctr9 G T 7: 111,055,544 R1094L unknown Het
Cyld A T 8: 88,734,926 I664L probably benign Het
Dvl2 C T 11: 70,009,449 P690S possibly damaging Het
Fbxo7 A C 10: 86,029,110 E94D probably damaging Het
Fstl5 A C 3: 76,589,092 K387N probably damaging Het
Gm884 T C 11: 103,617,474 probably benign Het
Gm9845 A C 3: 39,358,371 noncoding transcript Het
Hk1 T C 10: 62,275,744 D746G probably damaging Het
Lmbr1 A G 5: 29,263,393 probably null Het
Lrp2 C T 2: 69,519,914 A705T probably null Het
Mybpc3 A G 2: 91,121,722 probably null Het
Myo15b T A 11: 115,871,511 L1219Q probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfr1279 G T 2: 111,307,047 A281S possibly damaging Het
Olfr1465 A T 19: 13,314,189 I32N probably damaging Het
Olfr1467 T C 19: 13,365,177 V183A probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcnt T C 10: 76,385,841 T1984A probably benign Het
Plcg1 T C 2: 160,751,668 L251P probably benign Het
Plin1 T A 7: 79,721,572 D468V probably benign Het
Rnf19a T A 15: 36,265,963 probably benign Het
Rnf214 G A 9: 45,868,046 Q469* probably null Het
Rrp1b T G 17: 32,056,011 probably benign Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Sema3e A T 5: 14,225,553 E224V probably damaging Het
Sphkap A G 1: 83,407,999 S5P probably damaging Het
Stab1 A C 14: 31,157,440 Y694* probably null Het
Stambpl1 T C 19: 34,234,286 L249P probably benign Het
Thap4 A T 1: 93,714,943 H515Q probably damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Uaca A G 9: 60,872,098 R1256G probably benign Het
Usp17lb T A 7: 104,840,674 N348Y possibly damaging Het
Vmn1r42 A G 6: 89,845,332 I85T probably benign Het
Vps9d1 A T 8: 123,248,859 L149Q probably damaging Het
Zdhhc17 A T 10: 110,973,833 I153N probably damaging Het
Zfp207 G A 11: 80,393,133 S293N possibly damaging Het
Zfp346 A G 13: 55,122,357 D198G probably damaging Het
Zfp953 A T 13: 67,343,472 C139S possibly damaging Het
Other mutations in Pmp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Pmp2 APN 3 10182481 nonsense probably null
IGL02367:Pmp2 APN 3 10182500 missense probably damaging 1.00
IGL02479:Pmp2 APN 3 10182202 missense probably benign 0.00
R0419:Pmp2 UTSW 3 10180763 missense probably damaging 1.00
R1754:Pmp2 UTSW 3 10182224 critical splice acceptor site probably null
R1943:Pmp2 UTSW 3 10182510 missense probably benign 0.01
R5141:Pmp2 UTSW 3 10182414 missense probably benign 0.02
R6749:Pmp2 UTSW 3 10182482 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CCTGCAAAACTGTCTTCAAGTTCC -3'
(R):5'- AGGGTGAGTCACATGCTTTG -3'

Sequencing Primer
(F):5'- GTTCCATGCATTTAAATAGCTTTGTG -3'
(R):5'- CACATGCTTTGGGTTTCTTTGAAAAG -3'
Posted On2016-11-08