Incidental Mutation 'R5647:Vmn1r42'
ID441215
Institutional Source Beutler Lab
Gene Symbol Vmn1r42
Ensembl Gene ENSMUSG00000068232
Gene Namevomeronasal 1 receptor 42
SynonymsV1ra6
MMRRC Submission 043295-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5647 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location89842573-89876413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89845332 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 85 (I85T)
Ref Sequence ENSEMBL: ENSMUSP00000154442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089419] [ENSMUST00000226436] [ENSMUST00000227279]
Predicted Effect probably benign
Transcript: ENSMUST00000089419
AA Change: I85T

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086840
Gene: ENSMUSG00000068232
AA Change: I85T

DomainStartEndE-ValueType
Pfam:V1R 54 318 3.6e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226436
AA Change: I85T

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000227279
AA Change: I85T

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T C 7: 82,856,398 noncoding transcript Het
9330159F19Rik A T 10: 29,225,254 D541V probably damaging Het
9930021J03Rik A G 19: 29,753,810 S601P possibly damaging Het
Abcc5 T C 16: 20,399,847 I262V probably damaging Het
Acvr1c T A 2: 58,295,964 D169V probably damaging Het
Aldh16a1 A G 7: 45,154,465 V6A probably benign Het
Cd36 A C 5: 17,814,765 S113A probably damaging Het
Cdt1 G T 8: 122,570,208 R247L possibly damaging Het
Ces4a G A 8: 105,146,080 V322M probably benign Het
Cngb3 A T 4: 19,364,266 T157S possibly damaging Het
Cpped1 T C 16: 11,828,146 probably benign Het
Ctr9 G T 7: 111,055,544 R1094L unknown Het
Cyld A T 8: 88,734,926 I664L probably benign Het
Dvl2 C T 11: 70,009,449 P690S possibly damaging Het
Fbxo7 A C 10: 86,029,110 E94D probably damaging Het
Fstl5 A C 3: 76,589,092 K387N probably damaging Het
Gm884 T C 11: 103,617,474 probably benign Het
Gm9845 A C 3: 39,358,371 noncoding transcript Het
Hk1 T C 10: 62,275,744 D746G probably damaging Het
Lmbr1 A G 5: 29,263,393 probably null Het
Lrp2 C T 2: 69,519,914 A705T probably null Het
Mybpc3 A G 2: 91,121,722 probably null Het
Myo15b T A 11: 115,871,511 L1219Q probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfr1279 G T 2: 111,307,047 A281S possibly damaging Het
Olfr1465 A T 19: 13,314,189 I32N probably damaging Het
Olfr1467 T C 19: 13,365,177 V183A probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcnt T C 10: 76,385,841 T1984A probably benign Het
Plcg1 T C 2: 160,751,668 L251P probably benign Het
Plin1 T A 7: 79,721,572 D468V probably benign Het
Pmp2 A G 3: 10,183,785 V12A probably benign Het
Rnf19a T A 15: 36,265,963 probably benign Het
Rnf214 G A 9: 45,868,046 Q469* probably null Het
Rrp1b T G 17: 32,056,011 probably benign Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Sema3e A T 5: 14,225,553 E224V probably damaging Het
Sphkap A G 1: 83,407,999 S5P probably damaging Het
Stab1 A C 14: 31,157,440 Y694* probably null Het
Stambpl1 T C 19: 34,234,286 L249P probably benign Het
Thap4 A T 1: 93,714,943 H515Q probably damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Uaca A G 9: 60,872,098 R1256G probably benign Het
Usp17lb T A 7: 104,840,674 N348Y possibly damaging Het
Vps9d1 A T 8: 123,248,859 L149Q probably damaging Het
Zdhhc17 A T 10: 110,973,833 I153N probably damaging Het
Zfp207 G A 11: 80,393,133 S293N possibly damaging Het
Zfp346 A G 13: 55,122,357 D198G probably damaging Het
Zfp953 A T 13: 67,343,472 C139S possibly damaging Het
Other mutations in Vmn1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02055:Vmn1r42 APN 6 89845589 utr 5 prime probably benign
IGL02151:Vmn1r42 APN 6 89845041 missense possibly damaging 0.90
IGL02158:Vmn1r42 APN 6 89845314 missense probably damaging 0.96
IGL02731:Vmn1r42 APN 6 89845425 missense probably benign 0.41
IGL02738:Vmn1r42 APN 6 89844648 missense possibly damaging 0.69
IGL02817:Vmn1r42 APN 6 89845536 missense probably damaging 1.00
volkan UTSW 6 89844967 missense probably benign 0.00
R1131:Vmn1r42 UTSW 6 89845569 missense possibly damaging 0.88
R1500:Vmn1r42 UTSW 6 89845501 missense probably benign 0.01
R1557:Vmn1r42 UTSW 6 89844751 missense possibly damaging 0.66
R1561:Vmn1r42 UTSW 6 89845381 missense probably damaging 0.99
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1574:Vmn1r42 UTSW 6 89845381 missense probably damaging 0.99
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1857:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1858:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1916:Vmn1r42 UTSW 6 89844967 missense probably benign 0.00
R2284:Vmn1r42 UTSW 6 89844699 missense probably benign 0.26
R2912:Vmn1r42 UTSW 6 89844706 missense probably benign
R4541:Vmn1r42 UTSW 6 89845551 missense probably benign
R5085:Vmn1r42 UTSW 6 89844616 missense probably benign 0.00
R5384:Vmn1r42 UTSW 6 89845384 missense probably damaging 1.00
R5616:Vmn1r42 UTSW 6 89845102 missense possibly damaging 0.66
R5867:Vmn1r42 UTSW 6 89844779 nonsense probably null
R6569:Vmn1r42 UTSW 6 89845443 missense probably damaging 1.00
R6852:Vmn1r42 UTSW 6 89844787 missense possibly damaging 0.71
R7054:Vmn1r42 UTSW 6 89845069 missense possibly damaging 0.90
R7399:Vmn1r42 UTSW 6 89845513 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCTTGAACTTTGCTAAACAGGAG -3'
(R):5'- CCAGGAGGGATGGGTGATATTC -3'

Sequencing Primer
(F):5'- GAACTTTGCTAAACAGGAGCTTCTGG -3'
(R):5'- CTCAGTCAATGTTCTCACATACAATG -3'
Posted On2016-11-08