Incidental Mutation 'R5647:Fbxo7'
ID441229
Institutional Source Beutler Lab
Gene Symbol Fbxo7
Ensembl Gene ENSMUSG00000001786
Gene NameF-box protein 7
Synonyms2410015K21Rik, A230052G17Rik
MMRRC Submission 043295-MU
Accession Numbers

NCBI RefSeq: NM_153195.2; MGI: 1917004

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5647 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86021972-86051873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86029110 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 94 (E94D)
Ref Sequence ENSEMBL: ENSMUSP00000113222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001837] [ENSMUST00000117597] [ENSMUST00000120344] [ENSMUST00000130320] [ENSMUST00000147168]
Predicted Effect probably benign
Transcript: ENSMUST00000001837
SMART Domains Protein: ENSMUSP00000001837
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
Blast:UBQ 1 40 7e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000117597
AA Change: E92D

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113263
Gene: ENSMUSG00000001786
AA Change: E92D

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 101 245 9.6e-31 PFAM
Pfam:F-box 250 297 2.7e-6 PFAM
Pfam:F-box-like 252 298 7.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120344
AA Change: E94D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113222
Gene: ENSMUSG00000001786
AA Change: E94D

DomainStartEndE-ValueType
Pfam:PI31_Prot_N 103 247 4.8e-31 PFAM
Pfam:F-box 252 299 1.8e-6 PFAM
Pfam:F-box-like 254 300 5.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130320
AA Change: E173D

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120840
Gene: ENSMUSG00000001786
AA Change: E173D

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 78 7e-6 SMART
Blast:UBQ 1 79 6e-30 BLAST
Pfam:PI31_Prot_N 188 323 4.7e-20 PFAM
Pfam:F-box 331 378 9.7e-6 PFAM
Pfam:F-box-like 333 379 9.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134490
Predicted Effect probably benign
Transcript: ENSMUST00000147168
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 95% (55/58)
MGI Phenotype Strain: 4434927
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it may play a role in regulation of hematopoiesis. Alternatively spliced transcript variants of this gene have been identified with the full-length natures of only some variants being determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased pro-B cell numbers and increased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(4) Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T C 7: 82,856,398 noncoding transcript Het
9330159F19Rik A T 10: 29,225,254 D541V probably damaging Het
9930021J03Rik A G 19: 29,753,810 S601P possibly damaging Het
Abcc5 T C 16: 20,399,847 I262V probably damaging Het
Acvr1c T A 2: 58,295,964 D169V probably damaging Het
Aldh16a1 A G 7: 45,154,465 V6A probably benign Het
Cd36 A C 5: 17,814,765 S113A probably damaging Het
Cdt1 G T 8: 122,570,208 R247L possibly damaging Het
Ces4a G A 8: 105,146,080 V322M probably benign Het
Cngb3 A T 4: 19,364,266 T157S possibly damaging Het
Cpped1 T C 16: 11,828,146 probably benign Het
Ctr9 G T 7: 111,055,544 R1094L unknown Het
Cyld A T 8: 88,734,926 I664L probably benign Het
Dvl2 C T 11: 70,009,449 P690S possibly damaging Het
Fstl5 A C 3: 76,589,092 K387N probably damaging Het
Gm884 T C 11: 103,617,474 probably benign Het
Gm9845 A C 3: 39,358,371 noncoding transcript Het
Hk1 T C 10: 62,275,744 D746G probably damaging Het
Lmbr1 A G 5: 29,263,393 probably null Het
Lrp2 C T 2: 69,519,914 A705T probably null Het
Mybpc3 A G 2: 91,121,722 probably null Het
Myo15b T A 11: 115,871,511 L1219Q probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfr1279 G T 2: 111,307,047 A281S possibly damaging Het
Olfr1465 A T 19: 13,314,189 I32N probably damaging Het
Olfr1467 T C 19: 13,365,177 V183A probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcnt T C 10: 76,385,841 T1984A probably benign Het
Plcg1 T C 2: 160,751,668 L251P probably benign Het
Plin1 T A 7: 79,721,572 D468V probably benign Het
Pmp2 A G 3: 10,183,785 V12A probably benign Het
Rnf19a T A 15: 36,265,963 probably benign Het
Rnf214 G A 9: 45,868,046 Q469* probably null Het
Rrp1b T G 17: 32,056,011 probably benign Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Sema3e A T 5: 14,225,553 E224V probably damaging Het
Sphkap A G 1: 83,407,999 S5P probably damaging Het
Stab1 A C 14: 31,157,440 Y694* probably null Het
Stambpl1 T C 19: 34,234,286 L249P probably benign Het
Thap4 A T 1: 93,714,943 H515Q probably damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Uaca A G 9: 60,872,098 R1256G probably benign Het
Usp17lb T A 7: 104,840,674 N348Y possibly damaging Het
Vmn1r42 A G 6: 89,845,332 I85T probably benign Het
Vps9d1 A T 8: 123,248,859 L149Q probably damaging Het
Zdhhc17 A T 10: 110,973,833 I153N probably damaging Het
Zfp207 G A 11: 80,393,133 S293N possibly damaging Het
Zfp346 A G 13: 55,122,357 D198G probably damaging Het
Zfp953 A T 13: 67,343,472 C139S possibly damaging Het
Other mutations in Fbxo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Fbxo7 APN 10 86029064 missense probably damaging 0.98
IGL01483:Fbxo7 APN 10 86044581 missense probably damaging 1.00
IGL02502:Fbxo7 APN 10 86033297 missense probably damaging 1.00
IGL02712:Fbxo7 APN 10 86024438 missense possibly damaging 0.75
P0007:Fbxo7 UTSW 10 86033293 missense possibly damaging 0.95
R0410:Fbxo7 UTSW 10 86029238 critical splice donor site probably null
R4119:Fbxo7 UTSW 10 86021895 unclassified probably benign
R4604:Fbxo7 UTSW 10 86046802 missense probably damaging 1.00
R4884:Fbxo7 UTSW 10 86029150 missense probably damaging 0.99
R5088:Fbxo7 UTSW 10 86021920 unclassified probably benign
R5286:Fbxo7 UTSW 10 86022090 missense probably damaging 1.00
R5387:Fbxo7 UTSW 10 86024654 missense probably benign 0.01
R5451:Fbxo7 UTSW 10 86029037 missense probably benign 0.01
R5491:Fbxo7 UTSW 10 86048026 missense probably damaging 1.00
R5542:Fbxo7 UTSW 10 86033285 missense probably benign 0.00
R6027:Fbxo7 UTSW 10 86048086 missense probably damaging 1.00
R6152:Fbxo7 UTSW 10 86024696 missense probably benign 0.01
R6280:Fbxo7 UTSW 10 86029105 missense probably benign 0.00
R6615:Fbxo7 UTSW 10 86044534 missense possibly damaging 0.48
R7405:Fbxo7 UTSW 10 86044581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTAATCTCTGCTCAGTTTAGG -3'
(R):5'- TGTGAAGTACCCAGGGAGAC -3'

Sequencing Primer
(F):5'- TGCTCAGTTTAGGTTATAAAATGTCC -3'
(R):5'- CTCAGAGGTTCAGAGATTCAGTCC -3'
Posted On2016-11-08