Incidental Mutation 'R5647:Gm884'
ID441233
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission 043295-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R5647 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 103617474 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect unknown
Transcript: ENSMUST00000059279
AA Change: T1223A
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: T1223A

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167262
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T C 7: 82,856,398 noncoding transcript Het
9330159F19Rik A T 10: 29,225,254 D541V probably damaging Het
9930021J03Rik A G 19: 29,753,810 S601P possibly damaging Het
Abcc5 T C 16: 20,399,847 I262V probably damaging Het
Acvr1c T A 2: 58,295,964 D169V probably damaging Het
Aldh16a1 A G 7: 45,154,465 V6A probably benign Het
Cd36 A C 5: 17,814,765 S113A probably damaging Het
Cdt1 G T 8: 122,570,208 R247L possibly damaging Het
Ces4a G A 8: 105,146,080 V322M probably benign Het
Cngb3 A T 4: 19,364,266 T157S possibly damaging Het
Cpped1 T C 16: 11,828,146 probably benign Het
Ctr9 G T 7: 111,055,544 R1094L unknown Het
Cyld A T 8: 88,734,926 I664L probably benign Het
Dvl2 C T 11: 70,009,449 P690S possibly damaging Het
Fbxo7 A C 10: 86,029,110 E94D probably damaging Het
Fstl5 A C 3: 76,589,092 K387N probably damaging Het
Gm9845 A C 3: 39,358,371 noncoding transcript Het
Hk1 T C 10: 62,275,744 D746G probably damaging Het
Lmbr1 A G 5: 29,263,393 probably null Het
Lrp2 C T 2: 69,519,914 A705T probably null Het
Mybpc3 A G 2: 91,121,722 probably null Het
Myo15b T A 11: 115,871,511 L1219Q probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfr1279 G T 2: 111,307,047 A281S possibly damaging Het
Olfr1465 A T 19: 13,314,189 I32N probably damaging Het
Olfr1467 T C 19: 13,365,177 V183A probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcnt T C 10: 76,385,841 T1984A probably benign Het
Plcg1 T C 2: 160,751,668 L251P probably benign Het
Plin1 T A 7: 79,721,572 D468V probably benign Het
Pmp2 A G 3: 10,183,785 V12A probably benign Het
Rnf19a T A 15: 36,265,963 probably benign Het
Rnf214 G A 9: 45,868,046 Q469* probably null Het
Rrp1b T G 17: 32,056,011 probably benign Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Sema3e A T 5: 14,225,553 E224V probably damaging Het
Sphkap A G 1: 83,407,999 S5P probably damaging Het
Stab1 A C 14: 31,157,440 Y694* probably null Het
Stambpl1 T C 19: 34,234,286 L249P probably benign Het
Thap4 A T 1: 93,714,943 H515Q probably damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Uaca A G 9: 60,872,098 R1256G probably benign Het
Usp17lb T A 7: 104,840,674 N348Y possibly damaging Het
Vmn1r42 A G 6: 89,845,332 I85T probably benign Het
Vps9d1 A T 8: 123,248,859 L149Q probably damaging Het
Zdhhc17 A T 10: 110,973,833 I153N probably damaging Het
Zfp207 G A 11: 80,393,133 S293N possibly damaging Het
Zfp346 A G 13: 55,122,357 D198G probably damaging Het
Zfp953 A T 13: 67,343,472 C139S possibly damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGACTGGAGTTACAACCTG -3'
(R):5'- CTGCTACTGAGGGAGAACTTTC -3'

Sequencing Primer
(F):5'- GGACTGGAGTTACAACCTGTTTAG -3'
(R):5'- CTTTCTCAAACTGTGCAGGAGAGC -3'
Posted On2016-11-08