Mutagenetix > Incidental Mutation

Incidental Mutation 'R5648:Reln'

441262

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

043169-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R5648 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22089452-22549700 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22203570 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1228 (V1228A)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062372
AA Change: V1228A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: V1228A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161353

Predicted Effect

probably benign
Transcript: ENSMUST00000161356
AA Change: V1228A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: V1228A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162427

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	T	C	2: 25,326,510 (GRCm39)		probably null	Het
Alpk2	A	G	18: 65,482,988 (GRCm39)	V340A	probably damaging	Het
Cald1	G	T	6: 34,739,267 (GRCm39)		probably null	Het
Col24a1	C	T	3: 145,064,321 (GRCm39)	T702I	probably benign	Het
Ddx50	T	C	10: 62,452,049 (GRCm39)	R725G	unknown	Het
Dnah9	A	T	11: 65,818,581 (GRCm39)	F68L	probably benign	Het
Dnmt3b	G	A	2: 153,519,118 (GRCm39)	V651M	probably damaging	Het
Dock1	G	A	7: 134,348,683 (GRCm39)	C299Y	probably damaging	Het
Epha4	T	C	1: 77,375,162 (GRCm39)	I562V	probably benign	Het
Esco2	A	T	14: 66,068,641 (GRCm39)	V223D	probably damaging	Het
Ggt6	T	C	11: 72,326,542 (GRCm39)	I33T	possibly damaging	Het
Gm10392	A	T	11: 77,408,306 (GRCm39)	D104E	probably benign	Het
Gm9847	A	G	12: 14,545,130 (GRCm39)		noncoding transcript	Het
Gnao1	A	T	8: 94,676,070 (GRCm39)	Y116F	probably damaging	Het
Gvin1	A	T	7: 105,762,606 (GRCm39)	I621K	possibly damaging	Het
Hyal6	T	C	6: 24,734,235 (GRCm39)	M56T	possibly damaging	Het
Hyou1	T	A	9: 44,296,546 (GRCm39)	D490E	probably damaging	Het
Igsf10	G	C	3: 59,235,574 (GRCm39)	Q1536E	probably benign	Het
Klk1b8	T	C	7: 43,448,068 (GRCm39)	S31P	possibly damaging	Het
Map3k6	A	C	4: 132,970,646 (GRCm39)	I178L	probably benign	Het
Mycbp2	T	A	14: 103,528,778 (GRCm39)	N427Y	probably damaging	Het
Ncr1	T	A	7: 4,347,519 (GRCm39)	I228N	probably damaging	Het
Nefh	A	T	11: 4,895,233 (GRCm39)	Y319N	probably damaging	Het
Or4a80	A	C	2: 89,582,417 (GRCm39)	C252G	probably damaging	Het
Pakap	T	C	4: 57,854,848 (GRCm39)	V120A	probably damaging	Het
Pcdhb18	G	A	18: 37,623,537 (GRCm39)	R289Q	probably benign	Het
Pkhd1	T	A	1: 20,628,850 (GRCm39)	Y699F	probably benign	Het
Plekhd1	T	C	12: 80,767,362 (GRCm39)	L250P	probably damaging	Het
Rhobtb2	G	T	14: 70,034,593 (GRCm39)	R211S	probably damaging	Het
Rps6kb1	T	C	11: 86,403,697 (GRCm39)	I305V	possibly damaging	Het
Slc12a2	G	A	18: 58,029,382 (GRCm39)	G256E	possibly damaging	Het
Slc4a1ap	A	G	5: 31,708,129 (GRCm39)		probably null	Het
Thoc1	A	G	18: 9,962,390 (GRCm39)	T92A	possibly damaging	Het
Ticam1	TCACACA	TCACA	17: 56,577,629 (GRCm39)		probably null	Het
Tmem117	T	G	15: 94,992,653 (GRCm39)	S438A	possibly damaging	Het
Ttll7	A	G	3: 146,667,465 (GRCm39)	N777S	probably damaging	Het
Ubd	T	A	17: 37,506,345 (GRCm39)	V77E	probably damaging	Het
Ubqln3	A	G	7: 103,790,117 (GRCm39)	S658P	probably damaging	Het
Vmn1r78	G	A	7: 11,886,693 (GRCm39)	M101I	possibly damaging	Het
Wdr93	T	C	7: 79,426,974 (GRCm39)	C638R	probably benign	Het
Zfp983	T	A	17: 21,877,947 (GRCm39)	V50D	probably damaging	Het
Zhx3	A	T	2: 160,623,881 (GRCm39)	H95Q	probably damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,215,125 (GRCm39)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,250,007 (GRCm39)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,359,948 (GRCm39)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,265,378 (GRCm39)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,223,848 (GRCm39)	critical splice donor site	probably null
IGL00900:Reln	APN	5	22,185,115 (GRCm39)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	22,184,664 (GRCm39)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	22,191,965 (GRCm39)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	22,174,031 (GRCm39)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	22,124,067 (GRCm39)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,376,249 (GRCm39)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	22,174,077 (GRCm39)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	22,124,173 (GRCm39)	nonsense	probably null
IGL01361:Reln	APN	5	22,124,019 (GRCm39)	missense	probably benign	0.06
IGL01446:Reln	APN	5	22,174,315 (GRCm39)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,245,403 (GRCm39)	missense	probably benign	0.40
IGL01612:Reln	APN	5	22,101,928 (GRCm39)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	22,125,436 (GRCm39)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	22,152,512 (GRCm39)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,549,244 (GRCm39)	nonsense	probably null
IGL01875:Reln	APN	5	22,109,715 (GRCm39)	missense	probably benign
IGL02013:Reln	APN	5	22,155,877 (GRCm39)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	22,184,014 (GRCm39)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	22,114,956 (GRCm39)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	22,109,729 (GRCm39)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	22,115,990 (GRCm39)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,285,789 (GRCm39)	nonsense	probably null
IGL02408:Reln	APN	5	22,106,617 (GRCm39)	missense	probably benign	0.44
IGL02415:Reln	APN	5	22,176,949 (GRCm39)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,245,425 (GRCm39)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,239,750 (GRCm39)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,308,355 (GRCm39)	missense	probably benign	0.09
IGL02720:Reln	APN	5	22,202,939 (GRCm39)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	22,090,546 (GRCm39)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	22,200,363 (GRCm39)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	22,115,842 (GRCm39)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	22,115,834 (GRCm39)	missense	probably damaging	0.99
Fishing	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,311,058 (GRCm39)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	22,130,369 (GRCm39)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,209,134 (GRCm39)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,333,647 (GRCm39)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	22,153,447 (GRCm39)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0266:Reln	UTSW	5	22,193,774 (GRCm39)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,432,511 (GRCm39)	splice site	probably benign
R0333:Reln	UTSW	5	22,134,240 (GRCm39)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	22,155,820 (GRCm39)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,253,798 (GRCm39)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	22,125,494 (GRCm39)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	22,152,406 (GRCm39)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,256,274 (GRCm39)	splice site	probably benign
R0541:Reln	UTSW	5	22,185,107 (GRCm39)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,215,148 (GRCm39)	missense	probably benign	0.36
R0617:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,223,867 (GRCm39)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	22,118,228 (GRCm39)	missense	probably benign	0.44
R0704:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,432,626 (GRCm39)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,239,662 (GRCm39)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,239,773 (GRCm39)	missense	probably benign
R1163:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R1222:Reln	UTSW	5	22,191,953 (GRCm39)	missense	probably null	0.97
R1226:Reln	UTSW	5	22,115,864 (GRCm39)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,333,600 (GRCm39)	splice site	probably benign
R1532:Reln	UTSW	5	22,239,742 (GRCm39)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	22,165,376 (GRCm39)	missense	probably benign	0.01
R1565:Reln	UTSW	5	22,130,211 (GRCm39)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,265,366 (GRCm39)	missense	probably benign	0.01
R1636:Reln	UTSW	5	22,203,681 (GRCm39)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	22,134,084 (GRCm39)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	22,160,093 (GRCm39)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,215,287 (GRCm39)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	22,184,000 (GRCm39)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,249,960 (GRCm39)	critical splice donor site	probably null
R1991:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	22,147,625 (GRCm39)	missense	probably benign	0.01
R2072:Reln	UTSW	5	22,124,175 (GRCm39)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,223,998 (GRCm39)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	22,174,083 (GRCm39)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,253,003 (GRCm39)	missense	probably benign	0.30
R2219:Reln	UTSW	5	22,177,045 (GRCm39)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	22,192,076 (GRCm39)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	22,101,784 (GRCm39)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,359,954 (GRCm39)	missense	probably benign	0.00
R2321:Reln	UTSW	5	22,120,018 (GRCm39)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	22,184,688 (GRCm39)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,549,367 (GRCm39)	missense	unknown
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,245,418 (GRCm39)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	22,200,587 (GRCm39)	splice site	probably benign
R3713:Reln	UTSW	5	22,109,732 (GRCm39)	missense	probably damaging	0.99
R3770:Reln	UTSW	5	22,153,564 (GRCm39)	missense	probably damaging	1.00
R3836:Reln	UTSW	5	22,116,012 (GRCm39)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	22,115,847 (GRCm39)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	22,183,999 (GRCm39)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	22,200,364 (GRCm39)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,432,628 (GRCm39)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,333,630 (GRCm39)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,239,582 (GRCm39)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4298:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	22,106,741 (GRCm39)	missense	probably benign	0.44
R4615:Reln	UTSW	5	22,177,870 (GRCm39)	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22,357,461 (GRCm39)	missense	probably benign	0.17
R4720:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	22,124,220 (GRCm39)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,254,698 (GRCm39)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,549,183 (GRCm39)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,223,844 (GRCm39)	splice site	probably null
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4896:Reln	UTSW	5	22,160,236 (GRCm39)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	22,184,718 (GRCm39)	missense	probably benign	0.02
R4912:Reln	UTSW	5	22,130,191 (GRCm39)	missense	probably benign	0.29
R4922:Reln	UTSW	5	22,200,585 (GRCm39)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	22,165,424 (GRCm39)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,239,636 (GRCm39)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	22,153,510 (GRCm39)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	22,101,075 (GRCm39)	missense	probably benign	0.00
R5119:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5125:Reln	UTSW	5	22,118,239 (GRCm39)	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	22,153,627 (GRCm39)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	22,193,763 (GRCm39)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,308,395 (GRCm39)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,216,161 (GRCm39)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,244,527 (GRCm39)	missense	probably benign
R5400:Reln	UTSW	5	22,184,712 (GRCm39)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,209,201 (GRCm39)	missense	probably benign	0.00
R5514:Reln	UTSW	5	22,176,883 (GRCm39)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	22,137,713 (GRCm39)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,244,663 (GRCm39)	nonsense	probably null
R5649:Reln	UTSW	5	22,106,623 (GRCm39)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,311,081 (GRCm39)	missense	probably null	0.39
R5782:Reln	UTSW	5	22,223,054 (GRCm39)	missense	probably benign	0.01
R5815:Reln	UTSW	5	22,152,431 (GRCm39)	missense	probably damaging	0.99
R5838:Reln	UTSW	5	22,104,111 (GRCm39)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	22,116,048 (GRCm39)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	22,153,594 (GRCm39)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,265,331 (GRCm39)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,491,942 (GRCm39)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,357,482 (GRCm39)	nonsense	probably null
R6351:Reln	UTSW	5	22,106,661 (GRCm39)	nonsense	probably null
R6369:Reln	UTSW	5	22,256,359 (GRCm39)	missense	probably benign	0.03
R6371:Reln	UTSW	5	22,200,511 (GRCm39)	missense	probably benign
R6374:Reln	UTSW	5	22,285,712 (GRCm39)	missense	probably benign	0.06
R6425:Reln	UTSW	5	22,116,018 (GRCm39)	nonsense	probably null
R6442:Reln	UTSW	5	22,137,774 (GRCm39)	missense	probably benign
R6445:Reln	UTSW	5	22,124,212 (GRCm39)	missense	probably benign	0.05
R6554:Reln	UTSW	5	22,101,838 (GRCm39)	missense	probably damaging	1.00
R6641:Reln	UTSW	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
R6768:Reln	UTSW	5	22,183,905 (GRCm39)	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22,239,568 (GRCm39)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	22,104,177 (GRCm39)	missense	probably benign	0.18
R6932:Reln	UTSW	5	22,190,855 (GRCm39)	missense	probably benign	0.00
R6948:Reln	UTSW	5	22,177,033 (GRCm39)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	22,181,562 (GRCm39)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	22,120,085 (GRCm39)	nonsense	probably null
R7091:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably null	0.08
R7135:Reln	UTSW	5	22,181,594 (GRCm39)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,311,095 (GRCm39)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	22,147,618 (GRCm39)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,252,945 (GRCm39)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	22,183,921 (GRCm39)	missense	probably benign	0.03
R7393:Reln	UTSW	5	22,181,349 (GRCm39)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,256,365 (GRCm39)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	22,176,932 (GRCm39)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	22,176,951 (GRCm39)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,308,433 (GRCm39)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	22,147,739 (GRCm39)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	22,134,125 (GRCm39)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,432,636 (GRCm39)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	22,181,276 (GRCm39)	nonsense	probably null
R7588:Reln	UTSW	5	22,090,566 (GRCm39)	missense	probably benign	0.03
R7631:Reln	UTSW	5	22,176,933 (GRCm39)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	22,183,929 (GRCm39)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,244,633 (GRCm39)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,339,690 (GRCm39)	missense	probably benign	0.00
R7938:Reln	UTSW	5	22,155,870 (GRCm39)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	22,104,082 (GRCm39)	nonsense	probably null
R8062:Reln	UTSW	5	22,176,990 (GRCm39)	missense	probably benign	0.00
R8222:Reln	UTSW	5	22,136,475 (GRCm39)	nonsense	probably null
R8266:Reln	UTSW	5	22,223,085 (GRCm39)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,209,110 (GRCm39)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,209,229 (GRCm39)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	22,147,672 (GRCm39)	missense	probably benign	0.37
R8801:Reln	UTSW	5	22,155,854 (GRCm39)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	22,130,257 (GRCm39)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	22,090,512 (GRCm39)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	22,104,155 (GRCm39)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	22,184,577 (GRCm39)	missense	probably benign	0.00
R9022:Reln	UTSW	5	22,181,613 (GRCm39)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,253,036 (GRCm39)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,216,059 (GRCm39)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	22,130,198 (GRCm39)	missense	probably benign	0.01
R9126:Reln	UTSW	5	22,160,194 (GRCm39)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	22,155,815 (GRCm39)	critical splice donor site	probably null
R9182:Reln	UTSW	5	22,106,617 (GRCm39)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,357,471 (GRCm39)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,549,200 (GRCm39)	nonsense	probably null
R9241:Reln	UTSW	5	22,174,067 (GRCm39)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	22,120,151 (GRCm39)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	22,153,545 (GRCm39)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,209,209 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,193,705 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,285,689 (GRCm39)	missense	probably benign	0.01
R9309:Reln	UTSW	5	22,176,866 (GRCm39)	missense	probably benign	0.37
R9338:Reln	UTSW	5	22,202,937 (GRCm39)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,549,202 (GRCm39)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	22,120,105 (GRCm39)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,549,198 (GRCm39)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	22,125,508 (GRCm39)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	22,136,427 (GRCm39)	missense	probably benign	0.26
R9745:Reln	UTSW	5	22,152,525 (GRCm39)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	22,155,943 (GRCm39)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	22,184,022 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,209,080 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,174,239 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,432,634 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,359,957 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GTCTGAACCACAAATGAGCTAGC -3'
(R):5'- TTCCTTTCCCAGCCGTGAAG -3'

Sequencing Primer
(F):5'- ACTTTCTTACTGCAGAGGGGAAC -3'
(R):5'- CCGTGAAGGGTTTGTTTTTAATGCAG -3'

Posted On

2016-11-08