Incidental Mutation 'R5648:Zfp983'
ID441291
Institutional Source Beutler Lab
Gene Symbol Zfp983
Ensembl Gene ENSMUSG00000035868
Gene Namezinc finger protein 983
Synonyms3110052M02Rik
MMRRC Submission 043169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5648 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21657582-21662540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21659031 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 50 (V50D)
Ref Sequence ENSEMBL: ENSMUSP00000039392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039726]
Predicted Effect probably damaging
Transcript: ENSMUST00000039726
AA Change: V50D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039392
Gene: ENSMUSG00000035868
AA Change: V50D

DomainStartEndE-ValueType
KRAB 13 73 2.42e-22 SMART
ZnF_C2H2 185 207 5.5e-3 SMART
ZnF_C2H2 213 235 5.14e-3 SMART
ZnF_C2H2 241 263 4.54e-4 SMART
ZnF_C2H2 269 291 7.9e-4 SMART
ZnF_C2H2 297 319 2.86e-1 SMART
ZnF_C2H2 325 347 6.88e-4 SMART
ZnF_C2H2 353 375 1.95e-3 SMART
ZnF_C2H2 381 403 1.04e-3 SMART
ZnF_C2H2 409 431 2.79e-4 SMART
ZnF_C2H2 437 459 3.63e-3 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,436,498 probably null Het
Akap2 T C 4: 57,854,848 V120A probably damaging Het
Alpk2 A G 18: 65,349,917 V340A probably damaging Het
Cald1 G T 6: 34,762,332 probably null Het
Col24a1 C T 3: 145,358,566 T702I probably benign Het
Ddx50 T C 10: 62,616,270 R725G unknown Het
Dnah9 A T 11: 65,927,755 F68L probably benign Het
Dnmt3b G A 2: 153,677,198 V651M probably damaging Het
Dock1 G A 7: 134,746,954 C299Y probably damaging Het
Epha4 T C 1: 77,398,525 I562V probably benign Het
Esco2 A T 14: 65,831,192 V223D probably damaging Het
Ggt6 T C 11: 72,435,716 I33T possibly damaging Het
Gm10392 A T 11: 77,517,480 D104E probably benign Het
Gm9847 A G 12: 14,495,129 noncoding transcript Het
Gnao1 A T 8: 93,949,442 Y116F probably damaging Het
Gvin1 A T 7: 106,163,399 I621K possibly damaging Het
Hyal6 T C 6: 24,734,236 M56T possibly damaging Het
Hyou1 T A 9: 44,385,249 D490E probably damaging Het
Igsf10 G C 3: 59,328,153 Q1536E probably benign Het
Klk8 T C 7: 43,798,644 S31P possibly damaging Het
Map3k6 A C 4: 133,243,335 I178L probably benign Het
Mycbp2 T A 14: 103,291,342 N427Y probably damaging Het
Ncr1 T A 7: 4,344,520 I228N probably damaging Het
Nefh A T 11: 4,945,233 Y319N probably damaging Het
Olfr1253 A C 2: 89,752,073 C252G probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pkhd1 T A 1: 20,558,626 Y699F probably benign Het
Plekhd1 T C 12: 80,720,588 L250P probably damaging Het
Reln A G 5: 21,998,572 V1228A probably benign Het
Rhobtb2 G T 14: 69,797,144 R211S probably damaging Het
Rps6kb1 T C 11: 86,512,871 I305V possibly damaging Het
Slc12a2 G A 18: 57,896,310 G256E possibly damaging Het
Slc4a1ap A G 5: 31,550,785 probably null Het
Thoc1 A G 18: 9,962,390 T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem117 T G 15: 95,094,772 S438A possibly damaging Het
Ttll7 A G 3: 146,961,710 N777S probably damaging Het
Ubd T A 17: 37,195,454 V77E probably damaging Het
Ubqln3 A G 7: 104,140,910 S658P probably damaging Het
Vmn1r78 G A 7: 12,152,766 M101I possibly damaging Het
Wdr93 T C 7: 79,777,226 C638R probably benign Het
Zhx3 A T 2: 160,781,961 H95Q probably damaging Het
Other mutations in Zfp983
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Zfp983 APN 17 21657612 critical splice donor site probably null
IGL02492:Zfp983 APN 17 21657612 critical splice donor site probably null
IGL03145:Zfp983 APN 17 21659008 missense probably damaging 0.99
R0257:Zfp983 UTSW 17 21661440 missense probably benign 0.35
R1518:Zfp983 UTSW 17 21662353 missense probably damaging 1.00
R1925:Zfp983 UTSW 17 21662017 missense probably damaging 1.00
R2504:Zfp983 UTSW 17 21658967 missense probably damaging 1.00
R3701:Zfp983 UTSW 17 21661539 missense probably damaging 1.00
R4308:Zfp983 UTSW 17 21662208 missense probably benign 0.05
R6029:Zfp983 UTSW 17 21662485 missense probably benign 0.03
R6188:Zfp983 UTSW 17 21659019 missense probably damaging 1.00
R6662:Zfp983 UTSW 17 21662085 missense probably damaging 1.00
R7313:Zfp983 UTSW 17 21661497 missense probably damaging 0.97
R7361:Zfp983 UTSW 17 21661934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTTTCACAGAGGTAGAAC -3'
(R):5'- TGCATGGCACCTCTAAACTAG -3'

Sequencing Primer
(F):5'- TCCTATTTCCAGAAAAGCACTGTGC -3'
(R):5'- GCATGGCACCTCTAAACTAGAAAATG -3'
Posted On2016-11-08