Incidental Mutation 'R5649:Them4'
ID441308
Institutional Source Beutler Lab
Gene Symbol Them4
Ensembl Gene ENSMUSG00000028145
Gene Namethioesterase superfamily member 4
Synonyms2700077M13Rik, 4921507I02Rik
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location94310089-94332540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94331544 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 219 (L219F)
Ref Sequence ENSEMBL: ENSMUSP00000062841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049822]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049822
AA Change: L219F

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062841
Gene: ENSMUSG00000028145
AA Change: L219F

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:4HBT 139 213 8.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198353
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase B (PKB) is a major downstream target of receptor tyrosine kinases that signal via phosphatidylinositol 3-kinase. Upon cell stimulation, PKB is translocated to the plasma membrane, where it is phosphorylated in the C-terminal regulatory domain. The protein encoded by this gene negatively regulates PKB activity by inhibiting phosphorylation. Transcription of this gene is commonly downregulated in glioblastomas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit elongated mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Them4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Them4 APN 3 94323671 missense probably damaging 1.00
R0135:Them4 UTSW 3 94323570 splice site probably benign
R0586:Them4 UTSW 3 94329794 missense possibly damaging 0.95
R4345:Them4 UTSW 3 94329865 missense possibly damaging 0.93
R4998:Them4 UTSW 3 94329781 missense probably damaging 1.00
R5214:Them4 UTSW 3 94317511 missense probably benign 0.13
R6041:Them4 UTSW 3 94317499 missense possibly damaging 0.93
R6814:Them4 UTSW 3 94324371 missense probably damaging 1.00
R6872:Them4 UTSW 3 94324371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCAGCCAAAAGTTGATTC -3'
(R):5'- GCCATATTTCAGAGGCTGTTC -3'

Sequencing Primer
(F):5'- GGCTATACAGAGAGACCCTGTC -3'
(R):5'- CAGAGGCTGTTCTGAAGGGTC -3'
Posted On2016-11-08