Incidental Mutation 'R5649:0610009B22Rik'
List |< first << previous [record 10 of 386652] next >> last >|
ID441329
Institutional Source Beutler Lab
Gene Symbol 0610009B22Rik
Ensembl Gene ENSMUSG00000007777
Gene NameRIKEN cDNA 0610009B22 gene
Synonyms
Accession Numbers
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51685386-51688874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51685972 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 33 (E33G)
Ref Sequence ENSEMBL: ENSMUSP00000007921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007921] [ENSMUST00000109098]
Predicted Effect probably benign
Transcript: ENSMUST00000007921
AA Change: E33G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007921
Gene: ENSMUSG00000007777
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Sedlin_N 9 136 7.3e-52 PFAM
Pfam:Sybindin 46 137 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109098
AA Change: E33G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104726
Gene: ENSMUSG00000007777
AA Change: E33G

DomainStartEndE-ValueType
Pfam:Sedlin_N 9 136 1e-50 PFAM
Pfam:Sybindin 46 137 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T440N possibly damaging Het
C030039L03Rik T G 7: 27,703,981 C621G probably damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Csf3r A G 4: 126,043,814 E287G noncoding transcript Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
D6Wsu163e T A 6: 126,955,111 V145D noncoding transcript Het
Dennd4a C A 9: 64,851,209 probably null Het
Dlg2 T A 7: 91,968,239 V430E noncoding transcript Het
Dock4 T C 12: 40,844,540 S1938P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Gm1305 A G 1: 179,697,771 probably null Het
Gpihbp1 C A 15: 75,597,720 H132N noncoding transcript Het
Hpn T C 7: 31,099,332 I276V noncoding transcript Het
Ighd2-8 A G 12: 113,450,867 S1P not run Het
Itih3 T C 14: 30,921,418 N150S noncoding transcript Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Olfm3 A G 3: 115,096,924 R109G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr695 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y228* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Tanc1 G A 2: 59,820,326 V1053M noncoding transcript Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Other mutations in 0610009B22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:0610009B22Rik APN 11 51685843 missense probably damaging 0.99
R1657:0610009B22Rik UTSW 11 51685678 missense probably benign 0.00
R5157:0610009B22Rik UTSW 11 51686066 missense probably benign
R5387:0610009B22Rik UTSW 11 51685974 missense probably benign
R5541:0610009B22Rik UTSW 11 51685969 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCATGCAGCATGATGAGCC -3'
(R):5'- ATCATTTTAAATCAGTGGGGAGGG -3'

Sequencing Primer
(F):5'- ATGATGAGCCGCATGTGC -3'
(R):5'- GCCTGTAATACCAGCAGTTATGAGAC -3'
Posted OnNov 08, 2016