Incidental Mutation 'R5650:Slc7a4'
ID441397
Institutional Source Beutler Lab
Gene Symbol Slc7a4
Ensembl Gene ENSMUSG00000022756
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Synonyms
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17572018-17583214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 17575684 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 84 (L84M)
Ref Sequence ENSEMBL: ENSMUSP00000156098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023441] [ENSMUST00000063544] [ENSMUST00000090165] [ENSMUST00000164545] [ENSMUST00000164623] [ENSMUST00000171002] [ENSMUST00000172164] [ENSMUST00000231283] [ENSMUST00000231552] [ENSMUST00000231615] [ENSMUST00000231645] [ENSMUST00000231806] [ENSMUST00000232186] [ENSMUST00000232226] [ENSMUST00000232336] [ENSMUST00000232385]
Predicted Effect probably benign
Transcript: ENSMUST00000023441
SMART Domains Protein: ENSMUSP00000023441
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 385 7.9e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000063544
AA Change: L84M

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067243
Gene: ENSMUSG00000022756
AA Change: L84M

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 436 1.4e-49 PFAM
Pfam:AA_permease 41 426 9.4e-38 PFAM
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090165
AA Change: L84M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087627
Gene: ENSMUSG00000022756
AA Change: L84M

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 368 1.2e-42 PFAM
Pfam:AA_permease 41 370 2.7e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116648
Predicted Effect possibly damaging
Transcript: ENSMUST00000164545
AA Change: L149M

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130375
Gene: ENSMUSG00000022756
AA Change: L149M

DomainStartEndE-ValueType
Pfam:AA_permease_2 102 231 9.8e-15 PFAM
Pfam:AA_permease 106 230 2.7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164623
AA Change: L84M

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133167
Gene: ENSMUSG00000022756
AA Change: L84M

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 140 1.5e-14 PFAM
Pfam:AA_permease 41 140 6.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171002
SMART Domains Protein: ENSMUSP00000132727
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 197 1e-65 PFAM
Pfam:P2X_receptor 185 362 7e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172164
AA Change: L84M

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127280
Gene: ENSMUSG00000022756
AA Change: L84M

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 498 2.6e-46 PFAM
Pfam:AA_permease 41 423 4.5e-36 PFAM
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.5e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000231283
AA Change: L84M

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231552
AA Change: L84M

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231615
AA Change: L84M

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231645
AA Change: L149M

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000231806
Predicted Effect probably benign
Transcript: ENSMUST00000232186
Predicted Effect possibly damaging
Transcript: ENSMUST00000232226
AA Change: L84M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000232336
Predicted Effect possibly damaging
Transcript: ENSMUST00000232385
AA Change: L84M

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232429
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Slc7a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02717:Slc7a4 APN 16 17574575 missense possibly damaging 0.90
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0402:Slc7a4 UTSW 16 17575633 missense probably damaging 1.00
R1426:Slc7a4 UTSW 16 17573944 critical splice donor site probably null
R1926:Slc7a4 UTSW 16 17575704 missense probably damaging 1.00
R2097:Slc7a4 UTSW 16 17573455 splice site probably null
R2140:Slc7a4 UTSW 16 17574544 missense possibly damaging 0.91
R4496:Slc7a4 UTSW 16 17575812 missense probably damaging 1.00
R4548:Slc7a4 UTSW 16 17575345 missense probably benign 0.01
R4570:Slc7a4 UTSW 16 17574277 missense probably benign 0.00
R4631:Slc7a4 UTSW 16 17574391 missense probably damaging 1.00
R4658:Slc7a4 UTSW 16 17575933 missense probably damaging 1.00
R4825:Slc7a4 UTSW 16 17574521 missense probably damaging 1.00
R5102:Slc7a4 UTSW 16 17575618 missense probably damaging 1.00
R5364:Slc7a4 UTSW 16 17573363 missense probably benign 0.33
R5666:Slc7a4 UTSW 16 17575951 utr 5 prime probably benign
R5944:Slc7a4 UTSW 16 17574356 missense possibly damaging 0.95
R6769:Slc7a4 UTSW 16 17575320 missense possibly damaging 0.72
R7381:Slc7a4 UTSW 16 17575056 missense probably damaging 0.99
R7470:Slc7a4 UTSW 16 17575113 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCGTGAAGTTGCGAATGCTG -3'
(R):5'- CTGAAGCCACTGGAAGAGTC -3'

Sequencing Primer
(F):5'- AATGCTGTGGTTAAAGATGGCATCC -3'
(R):5'- CCACTGGAAGAGTCTAGCATG -3'
Posted On2016-11-08