Incidental Mutation 'R5651:Pappa'
ID441417
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission 043297-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R5651 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65156352 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably damaging
Transcript: ENSMUST00000084501
AA Change: E381G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: E381G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G A 11: 49,019,873 H578Y probably damaging Het
Atp11b A G 3: 35,855,140 D1161G probably damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
AY358078 T A 14: 51,822,160 V318D unknown Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Boc T A 16: 44,521,195 I16F probably benign Het
Brinp3 A T 1: 146,701,799 T191S probably benign Het
Cald1 T A 6: 34,762,320 N419K probably damaging Het
Cecr2 G A 6: 120,755,560 G471D probably damaging Het
Cftr T A 6: 18,255,365 probably null Het
Cyp2c38 T A 19: 39,460,712 T66S probably damaging Het
Dirc2 G A 16: 35,735,616 A158V probably benign Het
Fam212b C A 3: 105,716,432 Q22K probably damaging Het
Fbxo11 A T 17: 88,015,708 D83E probably benign Het
Fshr T A 17: 88,985,829 M474L possibly damaging Het
Hhla1 T A 15: 65,941,814 E223V probably damaging Het
Hnrnpa1 G C 15: 103,240,528 E5D possibly damaging Het
Htr2a T A 14: 74,705,703 V241E probably damaging Het
Ier5 T C 1: 155,098,745 E229G possibly damaging Het
Krt87 A T 15: 101,434,029 M276K possibly damaging Het
Mast1 G C 8: 84,928,968 Y182* probably null Het
Mia3 T A 1: 183,358,654 D239V probably damaging Het
Mpp7 A G 18: 7,355,016 probably null Het
Mut T A 17: 40,947,111 D389E probably damaging Het
Mycbp2 A G 14: 103,282,665 C739R probably null Het
Olfr1053 A G 2: 86,314,440 I282T probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr311 A T 11: 58,841,491 R126* probably null Het
Olfr70 C G 4: 43,696,636 C179S probably damaging Het
Palld A T 8: 61,538,788 I510N probably damaging Het
Phldb1 G A 9: 44,711,903 T618I probably damaging Het
Pkd1 A G 17: 24,591,387 E3631G possibly damaging Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Plk4 A G 3: 40,813,505 T828A probably benign Het
Psmb5 C T 14: 54,616,764 A86T possibly damaging Het
Rasal2 A G 1: 157,157,381 V907A probably damaging Het
Rxra C T 2: 27,737,341 T24M probably benign Het
Senp1 A G 15: 98,076,617 S105P probably benign Het
Sh3rf1 A G 8: 61,363,167 D486G probably damaging Het
Slfn5 A C 11: 82,960,664 N596H probably benign Het
Tanc2 T A 11: 105,798,700 D229E probably benign Het
Taok2 T C 7: 126,880,283 K57E probably damaging Het
Thsd7a C T 6: 12,343,213 C1135Y probably damaging Het
V1ra8 T C 6: 90,203,526 L237P probably benign Het
Vcpip1 G A 1: 9,747,840 T106M probably damaging Het
Vmn1r215 T G 13: 23,075,811 I7S possibly damaging Het
Vmn1r233 T A 17: 20,994,017 M224L probably benign Het
Xpot A T 10: 121,604,549 D592E probably damaging Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGGACACTAATTTGGAGCCC -3'
(R):5'- TCTTCATGAACGCAGGGTAGC -3'

Sequencing Primer
(F):5'- CCCTCTTTGTGGGCAGACAC -3'
(R):5'- CATCCCCAATCTTGCTGA -3'
Posted On2016-11-08