Incidental Mutation 'R5652:Cenpf'
ID441461
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R5652 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 189657082 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1518 (S1518P)
Ref Sequence ENSEMBL: ENSMUSP00000129738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165962] [ENSMUST00000171929]
Predicted Effect probably benign
Transcript: ENSMUST00000165962
SMART Domains Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 7.3e-135 PFAM
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 379 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 572 592 N/A INTRINSIC
internal_repeat_1 737 759 3.18e-5 PROSPERO
internal_repeat_1 751 773 3.18e-5 PROSPERO
internal_repeat_2 789 804 5.94e-5 PROSPERO
coiled coil region 812 864 N/A INTRINSIC
coiled coil region 885 923 N/A INTRINSIC
low complexity region 925 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171929
AA Change: S1518P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: S1518P

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0607:Cenpf UTSW 1 189682463 splice site probably null
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0653:Cenpf UTSW 1 189659986 missense probably damaging 1.00
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2074:Cenpf UTSW 1 189656901 missense probably damaging 1.00
R2096:Cenpf UTSW 1 189653459 missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2134:Cenpf UTSW 1 189658642 missense probably benign 0.03
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189652371 missense probably damaging 1.00
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6834:Cenpf UTSW 1 189659446 missense probably damaging 1.00
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7292:Cenpf UTSW 1 189650694 missense probably damaging 1.00
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAACTCAGTAACTGCTCAAG -3'
(R):5'- AACCTTGCAGGGTGACTTGG -3'

Sequencing Primer
(F):5'- GAACTCAGTAACTGCTCAAGCTTTTC -3'
(R):5'- CCTTGCAGGGTGACTTGGTAAAG -3'
Posted On2016-11-08