Incidental Mutation 'R5652:Olfr828'
ID441488
Institutional Source Beutler Lab
Gene Symbol Olfr828
Ensembl Gene ENSMUSG00000078116
Gene Nameolfactory receptor 828
SynonymsMOR149-1, GA_x6K02T2PVTD-12559294-12558356
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5652 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18814728-18819526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18815626 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 223 (S223P)
Ref Sequence ENSEMBL: ENSMUSP00000148853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104914] [ENSMUST00000213018] [ENSMUST00000215380]
Predicted Effect probably damaging
Transcript: ENSMUST00000104914
AA Change: S223P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100514
Gene: ENSMUSG00000078116
AA Change: S223P

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213018
AA Change: S223P
Predicted Effect probably damaging
Transcript: ENSMUST00000215380
AA Change: S223P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Olfr828
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Olfr828 APN 9 18815923 missense probably benign 0.03
IGL02103:Olfr828 APN 9 18815709 missense probably damaging 1.00
IGL02792:Olfr828 APN 9 18815958 missense probably benign 0.00
IGL02964:Olfr828 APN 9 18815728 missense probably damaging 1.00
IGL03087:Olfr828 APN 9 18816084 missense probably damaging 1.00
IGL03105:Olfr828 APN 9 18815389 missense probably benign 0.03
R0330:Olfr828 UTSW 9 18815641 missense probably damaging 1.00
R0335:Olfr828 UTSW 9 18815994 missense probably damaging 1.00
R0862:Olfr828 UTSW 9 18815706 missense probably damaging 0.98
R1226:Olfr828 UTSW 9 18815970 missense probably benign 0.34
R2004:Olfr828 UTSW 9 18815505 missense probably benign 0.05
R2005:Olfr828 UTSW 9 18815505 missense probably benign 0.05
R2006:Olfr828 UTSW 9 18815505 missense probably benign 0.05
R2199:Olfr828 UTSW 9 18815923 missense probably damaging 0.97
R2230:Olfr828 UTSW 9 18815725 missense probably damaging 1.00
R2399:Olfr828 UTSW 9 18816027 missense probably benign 0.07
R5738:Olfr828 UTSW 9 18815829 missense possibly damaging 0.81
R6416:Olfr828 UTSW 9 18815892 missense probably benign 0.21
R6813:Olfr828 UTSW 9 18815892 missense probably benign 0.21
X0026:Olfr828 UTSW 9 18815763 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGCTACCTCCATGTCTCTG -3'
(R):5'- CGGTTGTCCTTCTGCACAAAC -3'

Sequencing Primer
(F):5'- TGTGGGACCAATGTACACATC -3'
(R):5'- GTCCTTCTGCACAAACTTAGAAATC -3'
Posted On2016-11-08