Incidental Mutation 'R5621:Pcx'
ID441590
Institutional Source Beutler Lab
Gene Symbol Pcx
Ensembl Gene ENSMUSG00000024892
Gene Namepyruvate carboxylase
SynonymsPc
MMRRC Submission 043279-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5621 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4510472-4621752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4619167 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 731 (V731E)
Ref Sequence ENSEMBL: ENSMUSP00000153479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025823] [ENSMUST00000053597] [ENSMUST00000068004] [ENSMUST00000113822] [ENSMUST00000113825] [ENSMUST00000224675] [ENSMUST00000224707] [ENSMUST00000224726] [ENSMUST00000225264] [ENSMUST00000225375] [ENSMUST00000225476]
Predicted Effect probably benign
Transcript: ENSMUST00000025823
SMART Domains Protein: ENSMUSP00000025823
Gene: ENSMUSG00000024889

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
Pfam:Abi 147 267 1.4e-19 PFAM
transmembrane domain 283 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053597
SMART Domains Protein: ENSMUSP00000050039
Gene: ENSMUSG00000045045

DomainStartEndE-ValueType
LRRNT 16 52 1.16e0 SMART
LRR 71 94 3.86e0 SMART
LRR_TYP 95 118 9.44e-2 SMART
LRR 120 142 1.23e0 SMART
LRR 144 166 1.09e1 SMART
LRR_TYP 168 191 7.37e-4 SMART
LRR 192 215 1.45e1 SMART
LRRCT 234 279 1.27e-3 SMART
IGc2 293 358 3.35e-14 SMART
FN3 403 484 1.77e-2 SMART
transmembrane domain 517 539 N/A INTRINSIC
low complexity region 565 585 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068004
AA Change: V732E

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892
AA Change: V732E

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113822
SMART Domains Protein: ENSMUSP00000109453
Gene: ENSMUSG00000045045

DomainStartEndE-ValueType
LRRNT 16 52 1.16e0 SMART
LRR 71 94 3.86e0 SMART
LRR_TYP 95 118 9.44e-2 SMART
LRR 120 142 1.23e0 SMART
LRR 144 166 1.09e1 SMART
LRR_TYP 168 191 7.37e-4 SMART
LRR 192 215 1.45e1 SMART
LRRCT 234 279 1.27e-3 SMART
IGc2 293 358 3.35e-14 SMART
FN3 403 484 1.77e-2 SMART
transmembrane domain 517 539 N/A INTRINSIC
low complexity region 565 585 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113825
AA Change: V731E

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892
AA Change: V731E

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184483
Predicted Effect probably benign
Transcript: ENSMUST00000224675
Predicted Effect probably benign
Transcript: ENSMUST00000224707
Predicted Effect possibly damaging
Transcript: ENSMUST00000224726
AA Change: V731E

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000225264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225285
Predicted Effect probably benign
Transcript: ENSMUST00000225375
Predicted Effect probably benign
Transcript: ENSMUST00000225476
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T G 17: 84,695,993 L417R probably damaging Het
Als2 A G 1: 59,191,890 V854A probably benign Het
Bbox1 C T 2: 110,292,523 W140* probably null Het
Ccdc28a A T 10: 18,216,268 N110K probably benign Het
Chrna6 C T 8: 27,407,040 E270K probably damaging Het
Cilp A G 9: 65,278,791 K723E possibly damaging Het
Ciz1 C A 2: 32,371,741 A455E probably damaging Het
Csmd3 T G 15: 48,313,978 H388P possibly damaging Het
Dnajc8 A G 4: 132,553,252 probably benign Het
Dnase1 G T 16: 4,039,118 C164F probably benign Het
Dync2h1 A T 9: 7,120,909 I2126K possibly damaging Het
Epha4 G T 1: 77,515,049 probably benign Het
Fer1l6 T C 15: 58,558,326 C201R probably damaging Het
Fgf8 T C 19: 45,742,382 Y68C probably benign Het
Gabrb1 A T 5: 72,108,728 I243F probably damaging Het
Gm13762 T C 2: 88,973,466 I142V probably benign Het
Gm9774 G A 3: 92,428,357 A346V probably damaging Het
Gpam A C 19: 55,079,260 S484A probably damaging Het
Hectd2 T A 19: 36,618,751 N745K probably damaging Het
Hspa13 T C 16: 75,766,763 probably benign Het
Ints2 A G 11: 86,242,947 F426L probably benign Het
Ism1 A G 2: 139,678,721 T18A probably damaging Het
Itih2 T A 2: 10,102,805 Q650L probably benign Het
Jmjd4 T C 11: 59,450,393 F50S probably damaging Het
Kif5b T C 18: 6,226,883 N125S probably benign Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Lrfn1 A G 7: 28,466,836 I552V probably damaging Het
Mcph1 A G 8: 18,632,170 E441G probably damaging Het
Mdn1 T A 4: 32,716,371 H2144Q possibly damaging Het
Mms19 A G 19: 41,966,313 S56P probably benign Het
Mrgprb3 A G 7: 48,643,368 I145T probably benign Het
Myh11 G A 16: 14,244,855 T287I probably damaging Het
Npas2 A G 1: 39,359,713 T730A probably benign Het
Olfr1229 G A 2: 89,282,353 P281L probably damaging Het
Pcdhgb1 A G 18: 37,682,169 E571G possibly damaging Het
Pgm1 T A 5: 64,112,038 Y489* probably null Het
Rrp12 T C 19: 41,880,417 T541A probably benign Het
Ryr3 C T 2: 112,900,984 W660* probably null Het
Sertad2 T A 11: 20,648,061 F86I possibly damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc22a22 G T 15: 57,259,151 F143L probably benign Het
Slc22a28 C T 19: 8,071,011 V424I probably benign Het
Slc7a11 T G 3: 50,438,875 K106N probably damaging Het
Smgc A T 15: 91,844,420 D121V probably damaging Het
Sphk1 C T 11: 116,536,366 probably benign Het
Spock3 A T 8: 63,144,006 T118S probably benign Het
Stk17b G T 1: 53,771,784 S54* probably null Het
Sycp2 A G 2: 178,381,918 I435T probably benign Het
Tm2d3 G T 7: 65,701,618 D207Y probably damaging Het
Top2b A T 14: 16,387,280 N123Y probably damaging Het
Unc80 A G 1: 66,638,043 T2044A possibly damaging Het
Usp6nl A G 2: 6,440,432 S407G probably benign Het
Vmn1r195 G A 13: 22,278,389 V10I probably benign Het
Zfp292 C T 4: 34,811,703 R447H probably damaging Het
Other mutations in Pcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Pcx APN 19 4620937 missense probably benign 0.02
IGL01339:Pcx APN 19 4620235 unclassified probably null
IGL01373:Pcx APN 19 4620235 unclassified probably null
IGL01704:Pcx APN 19 4621060 missense probably damaging 1.00
IGL02223:Pcx APN 19 4601978 missense probably damaging 1.00
PIT4151001:Pcx UTSW 19 4603129 missense probably damaging 1.00
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0398:Pcx UTSW 19 4601610 missense probably benign 0.35
R0414:Pcx UTSW 19 4607642 missense possibly damaging 0.60
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1479:Pcx UTSW 19 4602024 missense probably damaging 1.00
R1543:Pcx UTSW 19 4602223 missense probably damaging 1.00
R1559:Pcx UTSW 19 4619086 missense probably damaging 1.00
R1607:Pcx UTSW 19 4603159 missense possibly damaging 0.89
R1833:Pcx UTSW 19 4619104 missense probably damaging 0.98
R1866:Pcx UTSW 19 4621221 missense possibly damaging 0.58
R2131:Pcx UTSW 19 4602551 missense probably benign 0.00
R2172:Pcx UTSW 19 4620881 missense probably benign 0.17
R2224:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2226:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2280:Pcx UTSW 19 4604543 missense probably damaging 1.00
R3950:Pcx UTSW 19 4617967 missense probably benign 0.00
R3952:Pcx UTSW 19 4617967 missense probably benign 0.00
R4205:Pcx UTSW 19 4619166 missense possibly damaging 0.95
R4409:Pcx UTSW 19 4610003 missense possibly damaging 0.65
R4670:Pcx UTSW 19 4619888 missense probably damaging 1.00
R4691:Pcx UTSW 19 4619477 missense probably damaging 0.99
R4728:Pcx UTSW 19 4603096 missense probably damaging 1.00
R4808:Pcx UTSW 19 4620928 missense probably benign 0.00
R5200:Pcx UTSW 19 4618504 missense probably damaging 1.00
R5454:Pcx UTSW 19 4602476 missense probably damaging 1.00
R5990:Pcx UTSW 19 4621266 missense probably damaging 1.00
R6519:Pcx UTSW 19 4602211 missense possibly damaging 0.64
R6526:Pcx UTSW 19 4604495 missense probably benign 0.44
R7202:Pcx UTSW 19 4602333 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACGTCTTCCGAGTCTTTGAC -3'
(R):5'- CACCTGCCCCTGATGTATCATG -3'

Sequencing Primer
(F):5'- AGTCTTTGACTCCCTCAACTACTTG -3'
(R):5'- CCCTGATGTATCATGGGTATGG -3'
Posted On2016-11-08