Incidental Mutation 'R5622:Ift172'
ID441621
Institutional Source Beutler Lab
Gene Symbol Ift172
Ensembl Gene ENSMUSG00000038564
Gene Nameintraflagellar transport 172
Synonymswim
MMRRC Submission 043161-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5622 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31253277-31291116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31283082 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 287 (Y287C)
Ref Sequence ENSEMBL: ENSMUSP00000049335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041565] [ENSMUST00000201809]
Predicted Effect probably damaging
Transcript: ENSMUST00000041565
AA Change: Y287C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564
AA Change: Y287C

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201274
Predicted Effect probably benign
Transcript: ENSMUST00000201809
SMART Domains Protein: ENSMUSP00000144425
Gene: ENSMUSG00000038564

DomainStartEndE-ValueType
WD40 2 44 3.8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202410
Predicted Effect probably benign
Transcript: ENSMUST00000202589
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport subcomplex IFT-B. Subcomplexes IFT-A and IFT-B are necessary for ciliary assembly and maintenance. Mutations in this gene have been associated with skeletal ciliopathies, with or without polydactyly, such as such short-rib thoracic dysplasias 1, 9 or 10. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis, neural tube defects, and developmental patterning abnormalities. Mice homozygous for a conditional allele activated in the early limb bud exhibit polydactyly and short limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,327,668 S320T probably benign Het
Alg8 T A 7: 97,386,799 probably benign Het
Anp32b G A 4: 46,469,930 E202K unknown Het
Apcdd1 A G 18: 62,936,902 probably null Het
Apobec2 A G 17: 48,423,416 V74A possibly damaging Het
Arid3c A T 4: 41,729,959 C79S probably benign Het
Atp1a2 A T 1: 172,291,427 probably benign Het
B2m A T 2: 122,150,990 N62I probably damaging Het
Borcs5 T C 6: 134,686,123 probably null Het
Cdk11b A G 4: 155,630,217 K127E probably damaging Het
Cep170 T C 1: 176,735,867 H726R possibly damaging Het
Col5a2 A C 1: 45,427,059 S190A probably benign Het
Cryba4 T C 5: 112,251,124 D5G probably damaging Het
Cyp2a5 T G 7: 26,835,874 V87G probably damaging Het
Cyr61 A G 3: 145,649,320 L60P probably damaging Het
Dcaf8 A G 1: 172,186,398 probably benign Het
Dchs1 A G 7: 105,755,293 S2681P probably benign Het
Ddx20 A G 3: 105,679,011 S673P probably damaging Het
Deptor T A 15: 55,181,032 I198N probably damaging Het
Ebf2 T C 14: 67,390,558 I334T possibly damaging Het
F5 A G 1: 164,192,565 R870G probably benign Het
Flg2 A C 3: 93,202,564 H633P unknown Het
Gm11938 T A 11: 99,603,293 probably null Het
Gm5771 A C 6: 41,396,150 N119H probably damaging Het
Gm6370 A G 5: 146,493,898 T298A probably benign Het
Gm9825 C T 6: 7,982,605 noncoding transcript Het
H60b C A 10: 22,283,542 probably benign Het
Hsbp1 A G 8: 119,344,585 T4A possibly damaging Het
Hsd3b3 A T 3: 98,742,208 D266E possibly damaging Het
Il20rb T A 9: 100,486,318 Q4L probably benign Het
Krt5 T C 15: 101,709,035 D421G probably damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Me3 A G 7: 89,796,663 D196G probably damaging Het
Mfsd12 T A 10: 81,363,627 V451E probably null Het
Mib1 A G 18: 10,794,503 N663S possibly damaging Het
Mtus2 A T 5: 148,078,434 N679I probably benign Het
Myt1 A G 2: 181,797,122 T146A probably benign Het
Neb T A 2: 52,270,269 H2244L probably damaging Het
Olfr1444 A C 19: 12,862,299 I175L probably benign Het
Olfr510 C T 7: 108,668,082 T222I probably benign Het
Olfr630 T C 7: 103,755,169 T139A probably damaging Het
Pabpc4 A G 4: 123,291,731 probably null Het
Padi1 C A 4: 140,824,955 V393L probably damaging Het
Pax2 A T 19: 44,818,466 D300V probably damaging Het
Pcgf2 T C 11: 97,690,252 E71G probably damaging Het
Pi4kb A G 3: 94,998,861 Q573R possibly damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pkd1 A G 17: 24,574,040 E1567G possibly damaging Het
Plcb2 A T 2: 118,714,729 S630R probably damaging Het
Prrt2 A T 7: 127,019,765 V176D probably benign Het
Prss42 T C 9: 110,799,422 probably null Het
Rhoq A G 17: 86,997,031 R197G probably benign Het
Rin2 A T 2: 145,860,379 T332S probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Setbp1 T A 18: 78,857,485 Y989F probably damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc35f5 G A 1: 125,589,956 R497Q probably damaging Het
Slf1 T C 13: 77,049,971 K728R probably benign Het
Tiparp T G 3: 65,547,525 S364A probably benign Het
Tph1 G A 7: 46,647,545 Q409* probably null Het
Trp73 A T 4: 154,060,592 I526N possibly damaging Het
Ttc9c G A 19: 8,815,968 R103* probably null Het
Vmn2r75 T A 7: 86,148,494 I704F probably benign Het
Wdr76 A G 2: 121,517,735 R63G probably damaging Het
Zc3h3 T A 15: 75,777,079 S735C probably damaging Het
Zfp383 G A 7: 29,912,190 V32M probably damaging Het
Zfp810 T A 9: 22,279,096 Y172F probably benign Het
Other mutations in Ift172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ift172 APN 5 31275896 missense probably damaging 1.00
IGL01399:Ift172 APN 5 31266248 missense probably benign
IGL01405:Ift172 APN 5 31261852 nonsense probably null
IGL01562:Ift172 APN 5 31267247 missense probably damaging 0.97
IGL01758:Ift172 APN 5 31280714 missense probably benign
IGL01792:Ift172 APN 5 31276871 missense probably damaging 1.00
IGL01830:Ift172 APN 5 31285292 missense probably damaging 1.00
IGL01839:Ift172 APN 5 31266350 missense probably damaging 1.00
IGL02007:Ift172 APN 5 31286604 missense probably benign 0.17
IGL02172:Ift172 APN 5 31281337 splice site probably benign
IGL02190:Ift172 APN 5 31254458 missense possibly damaging 0.51
IGL02334:Ift172 APN 5 31283058 missense probably benign 0.00
IGL02486:Ift172 APN 5 31257583 missense probably damaging 1.00
IGL02517:Ift172 APN 5 31253648 unclassified probably null
IGL02571:Ift172 APN 5 31257891 missense probably damaging 1.00
IGL02626:Ift172 APN 5 31264496 missense probably benign
IGL03183:Ift172 APN 5 31272004 missense probably benign 0.06
IGL03277:Ift172 APN 5 31267298 missense possibly damaging 0.92
IGL03349:Ift172 APN 5 31284130 missense probably benign 0.05
pushback UTSW 5 31286945 missense probably damaging 1.00
P0042:Ift172 UTSW 5 31261455 missense probably benign 0.35
PIT4802001:Ift172 UTSW 5 31285266 missense probably benign 0.03
R0153:Ift172 UTSW 5 31260624 missense probably benign
R0328:Ift172 UTSW 5 31263851 nonsense probably null
R0357:Ift172 UTSW 5 31257900 missense possibly damaging 0.51
R0369:Ift172 UTSW 5 31253641 missense probably damaging 1.00
R0391:Ift172 UTSW 5 31286667 missense probably damaging 1.00
R0512:Ift172 UTSW 5 31285477 missense possibly damaging 0.92
R0546:Ift172 UTSW 5 31257601 missense probably benign 0.14
R0553:Ift172 UTSW 5 31275842 splice site probably benign
R0606:Ift172 UTSW 5 31254313 missense probably damaging 0.99
R0834:Ift172 UTSW 5 31257371 missense probably benign
R0973:Ift172 UTSW 5 31257918 unclassified probably benign
R0973:Ift172 UTSW 5 31265355 missense probably benign
R1189:Ift172 UTSW 5 31285830 critical splice acceptor site probably null
R1205:Ift172 UTSW 5 31285792 missense probably benign
R1289:Ift172 UTSW 5 31280976 missense probably damaging 0.98
R1342:Ift172 UTSW 5 31261866 missense probably benign
R1395:Ift172 UTSW 5 31285238 unclassified probably benign
R1417:Ift172 UTSW 5 31256649 missense probably damaging 1.00
R2020:Ift172 UTSW 5 31267241 nonsense probably null
R2111:Ift172 UTSW 5 31286079 missense probably benign 0.04
R2175:Ift172 UTSW 5 31266685 missense probably damaging 1.00
R2509:Ift172 UTSW 5 31262968 missense probably benign
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R3705:Ift172 UTSW 5 31261437 critical splice donor site probably null
R3793:Ift172 UTSW 5 31257581 missense possibly damaging 0.61
R4385:Ift172 UTSW 5 31286967 missense probably damaging 1.00
R4477:Ift172 UTSW 5 31265437 missense probably benign 0.38
R4590:Ift172 UTSW 5 31253955 missense probably damaging 1.00
R4663:Ift172 UTSW 5 31284215 missense probably benign 0.01
R4665:Ift172 UTSW 5 31285254 missense possibly damaging 0.82
R4977:Ift172 UTSW 5 31272116 missense possibly damaging 0.79
R5109:Ift172 UTSW 5 31265986 missense probably benign 0.06
R5182:Ift172 UTSW 5 31267614 missense possibly damaging 0.51
R5343:Ift172 UTSW 5 31263812 missense probably benign 0.05
R5465:Ift172 UTSW 5 31261518 splice site probably null
R5718:Ift172 UTSW 5 31255277 missense possibly damaging 0.94
R5793:Ift172 UTSW 5 31276948 missense possibly damaging 0.96
R5870:Ift172 UTSW 5 31276940 missense probably benign 0.10
R5919:Ift172 UTSW 5 31260662 missense possibly damaging 0.63
R5968:Ift172 UTSW 5 31261484 missense probably damaging 1.00
R6112:Ift172 UTSW 5 31256897 missense probably benign
R6339:Ift172 UTSW 5 31256583 missense probably benign 0.00
R6339:Ift172 UTSW 5 31286945 missense probably damaging 1.00
R6355:Ift172 UTSW 5 31284157 missense probably benign 0.33
R6565:Ift172 UTSW 5 31275883 missense possibly damaging 0.68
R6668:Ift172 UTSW 5 31255339 missense probably benign 0.00
R6755:Ift172 UTSW 5 31260998 nonsense probably null
R6818:Ift172 UTSW 5 31265960 missense probably benign 0.01
R6939:Ift172 UTSW 5 31257586 missense probably damaging 1.00
R6980:Ift172 UTSW 5 31257386 missense probably benign
R7047:Ift172 UTSW 5 31275894 nonsense probably null
X0022:Ift172 UTSW 5 31285320 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATTGGAAAACTGTCCCTTGG -3'
(R):5'- AGGCCTGCCTTGATGGATTG -3'

Sequencing Primer
(F):5'- AAAACTGTCCCTTGGGGCCTC -3'
(R):5'- GGTGGCGTTAGCTTCCC -3'
Posted On2016-11-08