Incidental Mutation 'R5622:Zc3h3'
ID441650
Institutional Source Beutler Lab
Gene Symbol Zc3h3
Ensembl Gene ENSMUSG00000075600
Gene Namezinc finger CCCH type containing 3
SynonymsSmicl
MMRRC Submission 043161-MU
Accession Numbers

Genbank: NM_172121.1; Ensembl: ENSMUST00000100538

Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R5622 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location75754430-75841915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75777079 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 735 (S735C)
Ref Sequence ENSEMBL: ENSMUSP00000098106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100538]
Predicted Effect probably damaging
Transcript: ENSMUST00000100538
AA Change: S735C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098106
Gene: ENSMUSG00000075600
AA Change: S735C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 370 388 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
ZnF_C3H1 663 689 1.03e-2 SMART
ZnF_C3H1 690 716 1.16e-1 SMART
ZnF_C3H1 718 743 5.38e-6 SMART
ZnF_C3H1 745 771 2.88e-6 SMART
ZnF_C3H1 772 794 1.64e-1 SMART
low complexity region 839 888 N/A INTRINSIC
low complexity region 895 905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229970
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (69/71)
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,327,668 S320T probably benign Het
Alg8 T A 7: 97,386,799 probably benign Het
Anp32b G A 4: 46,469,930 E202K unknown Het
Apcdd1 A G 18: 62,936,902 probably null Het
Apobec2 A G 17: 48,423,416 V74A possibly damaging Het
Arid3c A T 4: 41,729,959 C79S probably benign Het
Atp1a2 A T 1: 172,291,427 probably benign Het
B2m A T 2: 122,150,990 N62I probably damaging Het
Borcs5 T C 6: 134,686,123 probably null Het
Cdk11b A G 4: 155,630,217 K127E probably damaging Het
Cep170 T C 1: 176,735,867 H726R possibly damaging Het
Col5a2 A C 1: 45,427,059 S190A probably benign Het
Cryba4 T C 5: 112,251,124 D5G probably damaging Het
Cyp2a5 T G 7: 26,835,874 V87G probably damaging Het
Cyr61 A G 3: 145,649,320 L60P probably damaging Het
Dcaf8 A G 1: 172,186,398 probably benign Het
Dchs1 A G 7: 105,755,293 S2681P probably benign Het
Ddx20 A G 3: 105,679,011 S673P probably damaging Het
Deptor T A 15: 55,181,032 I198N probably damaging Het
Ebf2 T C 14: 67,390,558 I334T possibly damaging Het
F5 A G 1: 164,192,565 R870G probably benign Het
Flg2 A C 3: 93,202,564 H633P unknown Het
Gm11938 T A 11: 99,603,293 probably null Het
Gm5771 A C 6: 41,396,150 N119H probably damaging Het
Gm6370 A G 5: 146,493,898 T298A probably benign Het
Gm9825 C T 6: 7,982,605 noncoding transcript Het
H60b C A 10: 22,283,542 probably benign Het
Hsbp1 A G 8: 119,344,585 T4A possibly damaging Het
Hsd3b3 A T 3: 98,742,208 D266E possibly damaging Het
Ift172 T C 5: 31,283,082 Y287C probably damaging Het
Il20rb T A 9: 100,486,318 Q4L probably benign Het
Krt5 T C 15: 101,709,035 D421G probably damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Me3 A G 7: 89,796,663 D196G probably damaging Het
Mfsd12 T A 10: 81,363,627 V451E probably null Het
Mib1 A G 18: 10,794,503 N663S possibly damaging Het
Mtus2 A T 5: 148,078,434 N679I probably benign Het
Myt1 A G 2: 181,797,122 T146A probably benign Het
Neb T A 2: 52,270,269 H2244L probably damaging Het
Olfr1444 A C 19: 12,862,299 I175L probably benign Het
Olfr510 C T 7: 108,668,082 T222I probably benign Het
Olfr630 T C 7: 103,755,169 T139A probably damaging Het
Pabpc4 A G 4: 123,291,731 probably null Het
Padi1 C A 4: 140,824,955 V393L probably damaging Het
Pax2 A T 19: 44,818,466 D300V probably damaging Het
Pcgf2 T C 11: 97,690,252 E71G probably damaging Het
Pi4kb A G 3: 94,998,861 Q573R possibly damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pkd1 A G 17: 24,574,040 E1567G possibly damaging Het
Plcb2 A T 2: 118,714,729 S630R probably damaging Het
Prrt2 A T 7: 127,019,765 V176D probably benign Het
Prss42 T C 9: 110,799,422 probably null Het
Rhoq A G 17: 86,997,031 R197G probably benign Het
Rin2 A T 2: 145,860,379 T332S probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Setbp1 T A 18: 78,857,485 Y989F probably damaging Het
Slc11a1 G A 1: 74,380,906 G191D probably damaging Het
Slc35f5 G A 1: 125,589,956 R497Q probably damaging Het
Slf1 T C 13: 77,049,971 K728R probably benign Het
Tiparp T G 3: 65,547,525 S364A probably benign Het
Tph1 G A 7: 46,647,545 Q409* probably null Het
Trp73 A T 4: 154,060,592 I526N possibly damaging Het
Ttc9c G A 19: 8,815,968 R103* probably null Het
Vmn2r75 T A 7: 86,148,494 I704F probably benign Het
Wdr76 A G 2: 121,517,735 R63G probably damaging Het
Zfp383 G A 7: 29,912,190 V32M probably damaging Het
Zfp810 T A 9: 22,279,096 Y172F probably benign Het
Other mutations in Zc3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Zc3h3 APN 15 75779313 missense probably damaging 1.00
1mM(1):Zc3h3 UTSW 15 75840565 critical splice acceptor site probably null
R0477:Zc3h3 UTSW 15 75777083 missense possibly damaging 0.93
R0843:Zc3h3 UTSW 15 75837479 missense probably benign 0.00
R1891:Zc3h3 UTSW 15 75756931 missense possibly damaging 0.47
R1918:Zc3h3 UTSW 15 75777118 missense probably damaging 1.00
R2009:Zc3h3 UTSW 15 75779309 missense probably damaging 1.00
R2257:Zc3h3 UTSW 15 75839566 missense possibly damaging 0.77
R3853:Zc3h3 UTSW 15 75837497 missense probably benign 0.03
R5130:Zc3h3 UTSW 15 75779290 missense probably damaging 1.00
R5160:Zc3h3 UTSW 15 75809663 missense probably benign 0.02
R5164:Zc3h3 UTSW 15 75777026 missense probably benign 0.02
R5279:Zc3h3 UTSW 15 75839590 missense probably benign 0.08
R5743:Zc3h3 UTSW 15 75779531 nonsense probably null
R5923:Zc3h3 UTSW 15 75785564 missense probably damaging 0.99
R6294:Zc3h3 UTSW 15 75809568 missense possibly damaging 0.90
R6377:Zc3h3 UTSW 15 75839455 missense probably damaging 0.99
R6735:Zc3h3 UTSW 15 75756634 missense probably benign 0.00
R7043:Zc3h3 UTSW 15 75809636 missense probably damaging 1.00
R7231:Zc3h3 UTSW 15 75840382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGTCATTTGTGAGATGGATG -3'
(R):5'- TGATGGTCTCCAGCAGAATCTG -3'

Sequencing Primer
(F):5'- TGGAATTACAGACCATCTCAAAGCTG -3'
(R):5'- CAGCAGAATCTGGGTGGCTG -3'
Posted On2016-11-08