Incidental Mutation 'R5624:Tmem132b'
ID441728
Institutional Source Beutler Lab
Gene Symbol Tmem132b
Ensembl Gene ENSMUSG00000070498
Gene Nametransmembrane protein 132B
Synonyms
MMRRC Submission 043163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5624 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location125531774-125792583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125622646 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 83 (S83G)
Ref Sequence ENSEMBL: ENSMUSP00000031446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031446] [ENSMUST00000185104]
Predicted Effect probably benign
Transcript: ENSMUST00000031446
AA Change: S83G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031446
Gene: ENSMUSG00000070498
AA Change: S83G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM132D_N 44 173 2.9e-53 PFAM
Pfam:TMEM132 432 774 5.9e-145 PFAM
Pfam:TMEM132D_C 870 953 1.3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184422
Predicted Effect probably benign
Transcript: ENSMUST00000185104
AA Change: S124G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T A 8: 119,615,105 probably null Het
Aoah A T 13: 20,995,479 N372I probably damaging Het
Ash1l T A 3: 88,985,609 D1598E probably damaging Het
Bcas2 T C 3: 103,173,261 C72R probably benign Het
Car9 T A 4: 43,509,146 F238Y probably benign Het
Ccnd1 T C 7: 144,938,012 S97G probably benign Het
Cfap52 C G 11: 67,927,358 C509S possibly damaging Het
Clcn4 C A 7: 7,288,944 V623L probably benign Het
Dnajc11 T C 4: 151,979,510 V483A probably benign Het
E2f8 G T 7: 48,877,961 D144E probably damaging Het
Epb41l1 G A 2: 156,533,771 probably benign Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam208b A G 13: 3,584,996 S604P possibly damaging Het
Fhit A G 14: 10,421,534 S85P probably damaging Het
Fzd8 G A 18: 9,213,268 G117S unknown Het
Gsdmc4 A G 15: 63,892,654 M379T possibly damaging Het
Hemk1 T C 9: 107,331,528 R157G probably benign Het
Il10 A G 1: 131,024,203 M158V probably benign Het
Jmjd1c G A 10: 67,233,414 M1656I probably damaging Het
Kit A T 5: 75,609,394 K155N probably benign Het
Lmtk3 C A 7: 45,786,862 A114E probably damaging Het
Lztr1 A G 16: 17,512,129 probably benign Het
Mras A G 9: 99,411,485 F34S probably damaging Het
Myo1c A G 11: 75,662,635 T516A probably damaging Het
Nme8 A C 13: 19,677,868 V197G possibly damaging Het
Olfr1089 T C 2: 86,732,805 D269G probably benign Het
Olfr1339 T A 4: 118,735,371 Y281N probably damaging Het
Pcdhb9 A T 18: 37,401,406 Y151F probably benign Het
Pcnx2 C T 8: 125,761,523 probably null Het
Plekhg4 T C 8: 105,380,750 F892S probably damaging Het
Prmt3 T A 7: 49,780,334 F62I probably damaging Het
Ralgapa1 T C 12: 55,612,738 Y1999C probably damaging Het
Rims2 A T 15: 39,345,413 Q204L possibly damaging Het
Slc6a16 T G 7: 45,261,108 H352Q probably benign Het
Snx9 T A 17: 5,891,809 C70* probably null Het
Srprb A G 9: 103,197,601 I114T probably damaging Het
Tas2r119 A T 15: 32,177,968 I227F probably damaging Het
Tg A T 15: 66,838,057 Y163F probably benign Het
Tm2d2 A G 8: 25,022,768 T211A probably damaging Het
Trav9-4 T C 14: 53,676,429 S47P probably benign Het
Vmn2r8 T A 5: 108,802,459 H174L probably damaging Het
Xrcc1 A G 7: 24,559,845 D85G possibly damaging Het
Zfp106 C G 2: 120,531,957 A34P probably damaging Het
Zfp608 A T 18: 54,898,272 N865K probably damaging Het
Zscan5b A G 7: 6,230,519 D114G probably benign Het
Other mutations in Tmem132b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Tmem132b APN 5 125698728 missense probably benign
IGL01518:Tmem132b APN 5 125778791 missense probably damaging 1.00
IGL02542:Tmem132b APN 5 125622494 missense probably damaging 1.00
IGL02652:Tmem132b APN 5 125787575 missense probably damaging 1.00
IGL02671:Tmem132b APN 5 125778727 missense probably damaging 0.97
IGL02951:Tmem132b APN 5 125787547 missense probably damaging 0.99
R0456:Tmem132b UTSW 5 125787724 missense probably damaging 0.99
R0462:Tmem132b UTSW 5 125785926 missense probably damaging 1.00
R0724:Tmem132b UTSW 5 125783421 missense possibly damaging 0.95
R1137:Tmem132b UTSW 5 125783542 missense possibly damaging 0.94
R1168:Tmem132b UTSW 5 125787019 missense probably damaging 0.99
R1418:Tmem132b UTSW 5 125638249 missense probably benign 0.01
R1689:Tmem132b UTSW 5 125787614 missense possibly damaging 0.95
R1744:Tmem132b UTSW 5 125778844 critical splice donor site probably null
R1835:Tmem132b UTSW 5 125785899 missense probably damaging 1.00
R2016:Tmem132b UTSW 5 125623016 missense probably benign
R2033:Tmem132b UTSW 5 125749289 missense probably damaging 0.98
R2097:Tmem132b UTSW 5 125638208 missense probably damaging 0.99
R2114:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2116:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2117:Tmem132b UTSW 5 125622551 missense probably damaging 1.00
R2870:Tmem132b UTSW 5 125638268 missense probably benign
R2870:Tmem132b UTSW 5 125638268 missense probably benign
R3807:Tmem132b UTSW 5 125787580 missense probably damaging 1.00
R4825:Tmem132b UTSW 5 125783433 missense probably benign
R5149:Tmem132b UTSW 5 125622925 missense probably damaging 0.99
R5484:Tmem132b UTSW 5 125787733 missense probably damaging 1.00
R5623:Tmem132b UTSW 5 125623352 missense probably damaging 0.99
R5775:Tmem132b UTSW 5 125638330 critical splice donor site probably null
R7012:Tmem132b UTSW 5 125698590 missense probably damaging 1.00
R7142:Tmem132b UTSW 5 125622673 missense probably damaging 1.00
R7308:Tmem132b UTSW 5 125787646 missense possibly damaging 0.88
R7414:Tmem132b UTSW 5 125787491 missense probably damaging 1.00
R7452:Tmem132b UTSW 5 125638268 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCTTTCTTGTGCAGAGAGC -3'
(R):5'- AGCCCATGCCAGTGACATAG -3'

Sequencing Primer
(F):5'- CAGAGAGCACAGGTCGAGGC -3'
(R):5'- CCAGTGACATAGAACAGTGTCTGC -3'
Posted On2016-11-08