Incidental Mutation 'R5627:Cyp3a59'
ID441882
Institutional Source Beutler Lab
Gene Symbol Cyp3a59
Ensembl Gene ENSMUSG00000061292
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 59
Synonyms
MMRRC Submission 043166-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5627 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location146079257-146113287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146112854 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 497 (D497E)
Ref Sequence ENSEMBL: ENSMUSP00000049494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035571] [ENSMUST00000199212]
Predicted Effect probably benign
Transcript: ENSMUST00000035571
AA Change: D497E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000049494
Gene: ENSMUSG00000061292
AA Change: D497E

DomainStartEndE-ValueType
Pfam:p450 38 493 5.3e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199212
SMART Domains Protein: ENSMUSP00000142591
Gene: ENSMUSG00000061292

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:p450 38 148 3.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abl1 T C 2: 31,800,583 W705R probably benign Het
Alpk1 A T 3: 127,680,647 V569D probably damaging Het
Ano3 T C 2: 110,756,953 N425S possibly damaging Het
Atad2b A G 12: 4,917,911 D68G probably benign Het
Cacna1e A G 1: 154,635,858 I173T probably damaging Het
Cenpe G T 3: 135,235,473 L716F possibly damaging Het
Cep85 A T 4: 134,134,097 L622Q probably damaging Het
Cep97 A G 16: 55,924,967 probably null Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chil5 A G 3: 106,019,635 L228P probably damaging Het
Col22a1 T C 15: 71,981,918 E265G probably damaging Het
Col3a1 T C 1: 45,331,560 probably benign Het
Egfem1 G T 3: 29,668,399 E175* probably null Het
Eif4g2 A G 7: 111,074,239 Y778H probably benign Het
Fam98b T C 2: 117,267,933 C295R probably damaging Het
Gm3149 A T 14: 4,324,703 I246L probably benign Het
Gm5134 A G 10: 75,986,108 T259A possibly damaging Het
Gm5150 A G 3: 15,963,400 Y236H probably damaging Het
Golga2 C A 2: 32,306,047 Y864* probably null Het
Inpp4a A G 1: 37,367,773 D199G probably damaging Het
Inpp4b T C 8: 81,743,816 probably benign Het
Kremen1 T C 11: 5,199,709 T321A probably benign Het
Map3k3 A G 11: 106,148,602 S250G probably benign Het
Mtmr10 A T 7: 64,336,752 K526M probably damaging Het
Nbea C T 3: 55,992,345 C1461Y probably damaging Het
Nckap5l A T 15: 99,427,706 N305K possibly damaging Het
Nup210l A T 3: 90,144,250 Y567F probably damaging Het
Olfr1002 T A 2: 85,647,647 I225F probably damaging Het
Olfr1242 A T 2: 89,494,044 N89K probably benign Het
Olfr1446 T A 19: 12,890,299 I93F probably damaging Het
Olfr292 G T 7: 86,695,139 V228F possibly damaging Het
Olfr661 G A 7: 104,688,170 V52M probably benign Het
Olfr742 A G 14: 50,515,800 M199V probably benign Het
Rcc1 T C 4: 132,338,143 R57G probably damaging Het
Rfx7 C T 9: 72,532,784 probably benign Het
Saraf T A 8: 34,154,645 M1K probably null Het
Serpinb9d C T 13: 33,202,693 T248I probably damaging Het
Slc38a6 A G 12: 73,343,683 I254M possibly damaging Het
Slc6a5 A G 7: 49,911,774 D18G possibly damaging Het
Supt20 A G 3: 54,713,190 D389G possibly damaging Het
Tecpr2 T A 12: 110,941,482 I1001K probably damaging Het
Vcan CAAAA CAA 13: 89,691,135 probably null Het
Wdr36 T A 18: 32,861,638 D717E possibly damaging Het
Zfp318 T C 17: 46,413,136 S2022P probably damaging Het
Other mutations in Cyp3a59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Cyp3a59 APN 5 146102861 missense probably damaging 0.99
IGL01129:Cyp3a59 APN 5 146098279 missense probably benign 0.06
IGL01628:Cyp3a59 APN 5 146099819 missense possibly damaging 0.94
IGL01982:Cyp3a59 APN 5 146104735 missense probably benign 0.00
IGL02094:Cyp3a59 APN 5 146104821 missense probably benign 0.05
IGL02140:Cyp3a59 APN 5 146102880 missense probably damaging 1.00
IGL02350:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02357:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02445:Cyp3a59 APN 5 146096653 missense probably benign 0.00
IGL02681:Cyp3a59 APN 5 146090746 splice site probably benign
IGL02870:Cyp3a59 APN 5 146098184 missense probably benign
IGL03023:Cyp3a59 APN 5 146085850 missense probably benign 0.02
PIT4802001:Cyp3a59 UTSW 5 146102801 missense probably benign 0.00
R0220:Cyp3a59 UTSW 5 146098270 missense probably benign 0.02
R0532:Cyp3a59 UTSW 5 146096653 nonsense probably null
R1084:Cyp3a59 UTSW 5 146096674 missense probably benign
R1263:Cyp3a59 UTSW 5 146104711 missense probably damaging 1.00
R1573:Cyp3a59 UTSW 5 146102874 missense probably damaging 1.00
R1747:Cyp3a59 UTSW 5 146104758 missense probably benign
R1759:Cyp3a59 UTSW 5 146098250 missense probably benign 0.10
R1812:Cyp3a59 UTSW 5 146102811 missense probably damaging 1.00
R1937:Cyp3a59 UTSW 5 146094377 missense possibly damaging 0.80
R2026:Cyp3a59 UTSW 5 146096288 missense probably damaging 1.00
R2060:Cyp3a59 UTSW 5 146104714 missense probably damaging 1.00
R2355:Cyp3a59 UTSW 5 146099812 missense probably benign 0.09
R3721:Cyp3a59 UTSW 5 146096597 missense probably damaging 0.96
R4013:Cyp3a59 UTSW 5 146079383 missense probably benign 0.01
R4421:Cyp3a59 UTSW 5 146104903 splice site probably null
R4432:Cyp3a59 UTSW 5 146104786 missense probably benign 0.04
R4633:Cyp3a59 UTSW 5 146094438 missense probably damaging 1.00
R4843:Cyp3a59 UTSW 5 146096261 missense possibly damaging 0.61
R4886:Cyp3a59 UTSW 5 146087387 missense probably damaging 1.00
R5236:Cyp3a59 UTSW 5 146102825 missense probably benign 0.20
R5386:Cyp3a59 UTSW 5 146085768 missense probably benign 0.01
R5792:Cyp3a59 UTSW 5 146099851 missense possibly damaging 0.92
R5935:Cyp3a59 UTSW 5 146090645 nonsense probably null
R6531:Cyp3a59 UTSW 5 146098217 missense probably benign 0.00
R6790:Cyp3a59 UTSW 5 146096333 missense probably benign
R7108:Cyp3a59 UTSW 5 146096333 missense probably benign
R7222:Cyp3a59 UTSW 5 146096575 critical splice acceptor site probably null
R7447:Cyp3a59 UTSW 5 146087405 missense probably benign 0.25
R7457:Cyp3a59 UTSW 5 146104750 missense probably damaging 1.00
Z1088:Cyp3a59 UTSW 5 146098222 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCCAGTCTCAGTGAATATAAAGGC -3'
(R):5'- GATGATACACTGCAGAGCCAC -3'

Sequencing Primer
(F):5'- ACACATGGTGATATACAGTGTATTTG -3'
(R):5'- AGAGCCACTGAGCATGTTC -3'
Posted On2016-11-08