Incidental Mutation 'R5629:Skint6'
ID441968
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Nameselection and upkeep of intraepithelial T cells 6
SynonymsOTTMUSG00000008519
MMRRC Submission 043280-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5629 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location112804616-113286973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113012979 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 594 (T594I)
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
Predicted Effect possibly damaging
Transcript: ENSMUST00000138966
AA Change: T594I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: T594I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171224
AA Change: T594I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: T594I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,857,163 D189N probably benign Het
Adamts9 A T 6: 92,798,133 V1052D probably damaging Het
Apob T C 12: 8,007,847 Y2077H probably damaging Het
Apol7e A T 15: 77,718,076 K291N probably benign Het
Arsk A T 13: 76,093,908 I82N probably damaging Het
Art1 A G 7: 102,107,079 Q159R probably benign Het
Atp2a2 A G 5: 122,460,096 V733A probably damaging Het
Btn2a2 A T 13: 23,481,960 probably null Het
Catsper1 C T 19: 5,336,137 P133S probably benign Het
Celsr3 A G 9: 108,849,067 D3165G probably benign Het
Cldn19 T A 4: 119,256,919 V86E probably damaging Het
Ctnna1 T A 18: 35,249,749 D649E probably benign Het
Cttnbp2 A G 6: 18,405,218 I1094T probably damaging Het
Ddx24 T C 12: 103,425,547 probably benign Het
Ern2 T A 7: 122,170,166 H879L probably damaging Het
Etv4 T A 11: 101,771,925 H277L probably damaging Het
Faap100 G T 11: 120,377,011 A312D probably damaging Het
Glipr1l1 G A 10: 112,078,403 C223Y possibly damaging Het
Gna14 T C 19: 16,436,733 S14P possibly damaging Het
Hapln1 A G 13: 89,601,515 T60A probably damaging Het
Hars2 T A 18: 36,788,666 Y273* probably null Het
Ighv5-6 A T 12: 113,625,622 Y79* probably null Het
Iqgap2 T A 13: 95,632,174 N1406I probably damaging Het
Kalrn T C 16: 34,039,934 T215A possibly damaging Het
Krtap13-1 T A 16: 88,729,159 S90R probably benign Het
Mettl8 T C 2: 70,965,569 I372V probably benign Het
Mfn1 A T 3: 32,561,510 T341S possibly damaging Het
Mocos T A 18: 24,664,085 probably null Het
Muc5b T C 7: 141,861,299 S2661P possibly damaging Het
Myo15 C T 11: 60,479,752 P1113S probably benign Het
Myo5a A T 9: 75,203,845 I1540F possibly damaging Het
Myoc T C 1: 162,648,587 Y287H probably damaging Het
Napepld A G 5: 21,675,903 F165L probably benign Het
Ndufb10 T C 17: 24,722,682 E102G probably damaging Het
Nrros T A 16: 32,144,405 I265F probably damaging Het
Nrxn1 A T 17: 90,590,032 F891I possibly damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Oas2 G A 5: 120,738,451 Q476* probably null Het
Olfr561 A T 7: 102,774,640 I39F possibly damaging Het
Pcnx2 C A 8: 125,898,041 W14L probably damaging Het
Piwil2 C T 14: 70,422,967 V70M probably damaging Het
Prss23 A C 7: 89,510,192 V223G probably damaging Het
Rarres2 A T 6: 48,570,260 L122Q probably benign Het
Robo1 T C 16: 72,983,710 V776A probably benign Het
Robo3 G A 9: 37,419,211 Q1008* probably null Het
Robo4 G A 9: 37,408,362 C636Y probably damaging Het
Sacm1l A G 9: 123,566,399 M196V probably benign Het
Sept7 T A 9: 25,288,293 Y163N probably damaging Het
Slc23a1 T C 18: 35,626,492 H13R probably benign Het
Slc25a39 A C 11: 102,404,893 Y109* probably null Het
Slc8a3 G A 12: 81,199,631 R883C probably damaging Het
Spag17 A T 3: 100,080,119 Y1575F probably benign Het
Spdye4c T A 2: 128,596,785 I321N probably damaging Het
Stk32b G A 5: 37,457,232 P311S probably damaging Het
Svs3a T A 2: 164,290,120 S203T probably benign Het
Taf3 A T 2: 9,918,178 I45N probably damaging Het
Taf7 T C 18: 37,643,502 N4S probably benign Het
Tial1 T A 7: 128,444,697 D87V probably damaging Het
Tmem120a T A 5: 135,742,050 E78V probably benign Het
Tmem19 A G 10: 115,347,260 F137L probably benign Het
Tmem55b T C 14: 50,927,916 H278R probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trim30d T C 7: 104,487,929 K23E possibly damaging Het
Ubxn7 C A 16: 32,332,299 H4Q unknown Het
Usp40 C T 1: 87,981,009 R590H probably benign Het
Vmn1r90 A G 7: 14,562,086 M22T possibly damaging Het
Vmn2r1 G A 3: 64,105,117 V800M possibly damaging Het
Vps11 A T 9: 44,356,376 I313N probably damaging Het
Zhx1 A G 15: 58,054,811 V13A probably damaging Het
Zic4 G A 9: 91,378,752 R20H probably benign Het
Zp3r C T 1: 130,582,879 V369M probably damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112804682 missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113236440 missense probably benign 0.37
IGL01343:Skint6 APN 4 113283626 missense probably benign 0.07
IGL01543:Skint6 APN 4 112899963 missense probably benign 0.18
IGL01633:Skint6 APN 4 113238049 missense probably damaging 1.00
IGL01818:Skint6 APN 4 112948569 missense probably benign 0.18
IGL02124:Skint6 APN 4 113087796 missense probably benign
IGL02517:Skint6 APN 4 112948540 splice site probably benign
IGL02647:Skint6 APN 4 113127891 splice site probably benign
IGL02887:Skint6 APN 4 113238184 nonsense probably null
IGL03026:Skint6 APN 4 112991244 splice site probably null
IGL03030:Skint6 APN 4 113012956 missense probably benign 0.03
PIT4576001:Skint6 UTSW 4 113053367 missense possibly damaging 0.91
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0099:Skint6 UTSW 4 112811501 missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113184814 splice site probably benign
R0164:Skint6 UTSW 4 112991236 splice site probably benign
R0312:Skint6 UTSW 4 112809100 missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112858169 splice site probably benign
R0762:Skint6 UTSW 4 112865651 splice site probably benign
R0941:Skint6 UTSW 4 113238358 missense probably damaging 1.00
R1023:Skint6 UTSW 4 113238103 missense probably benign 0.20
R1132:Skint6 UTSW 4 112898099 critical splice donor site probably null
R1228:Skint6 UTSW 4 112854452 missense probably benign
R1338:Skint6 UTSW 4 113012961 missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112869524 splice site probably benign
R1512:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R1577:Skint6 UTSW 4 113148523 missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113177037 splice site probably benign
R1762:Skint6 UTSW 4 113236481 missense probably damaging 0.98
R1891:Skint6 UTSW 4 112846696 missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112891990 missense probably benign
R2069:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R2089:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2144:Skint6 UTSW 4 113236260 missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112854452 missense probably benign 0.01
R2192:Skint6 UTSW 4 112865712 nonsense probably null
R2267:Skint6 UTSW 4 112842822 intron probably null
R2312:Skint6 UTSW 4 113238142 missense probably damaging 1.00
R2324:Skint6 UTSW 4 112872457 splice site probably null
R2342:Skint6 UTSW 4 113176983 missense probably benign 0.00
R3028:Skint6 UTSW 4 113236493 missense possibly damaging 0.92
R3704:Skint6 UTSW 4 113136472 missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112842899 splice site probably benign
R3760:Skint6 UTSW 4 112937458 missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112937437 missense probably benign
R4377:Skint6 UTSW 4 113236518 missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113156486 missense probably benign 0.01
R4611:Skint6 UTSW 4 113074076 missense probably benign
R4780:Skint6 UTSW 4 113236397 missense probably damaging 0.98
R4788:Skint6 UTSW 4 113238336 missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112955392 intron probably benign
R4900:Skint6 UTSW 4 113067470 missense probably benign 0.03
R4972:Skint6 UTSW 4 112835068 missense probably benign
R5008:Skint6 UTSW 4 112991255 missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113171533 critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113236268 missense probably damaging 0.99
R5165:Skint6 UTSW 4 112865668 missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112894924 intron probably null
R5310:Skint6 UTSW 4 113184768 nonsense probably null
R5423:Skint6 UTSW 4 112850740 missense possibly damaging 0.93
R5436:Skint6 UTSW 4 113096591 missense probably benign 0.08
R5447:Skint6 UTSW 4 113105909 missense probably benign 0.34
R5564:Skint6 UTSW 4 112988965 missense possibly damaging 0.72
R5936:Skint6 UTSW 4 113096593 missense probably benign 0.33
R5993:Skint6 UTSW 4 112809079 missense probably benign 0.02
R6027:Skint6 UTSW 4 113096564 splice site probably null
R6174:Skint6 UTSW 4 112839313 missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113236398 missense probably damaging 0.98
R6552:Skint6 UTSW 4 113067490 missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112892038 missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112948380 intron probably null
R7003:Skint6 UTSW 4 113105912 missense probably benign 0.01
R7211:Skint6 UTSW 4 113238369 missense probably benign 0.09
R7269:Skint6 UTSW 4 112854489 intron probably null
R7398:Skint6 UTSW 4 112898138 missense probably benign 0.00
R7438:Skint6 UTSW 4 113238228 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCATAGCAGCTAGGGATACAGTG -3'
(R):5'- TCATCCCCACATGTGATGTATATG -3'

Sequencing Primer
(F):5'- GGATACAGTGGCATCATGAAAATCCC -3'
(R):5'- CCACATGTGATGTATATGGGCCAC -3'
Posted On2016-11-08