Incidental Mutation 'R5630:Cntnap5b'
ID442033
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Namecontactin associated protein-like 5B
SynonymsCaspr5-2, C230078M14Rik
MMRRC Submission 043281-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R5630 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location99772765-100485942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100072069 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 184 (D184G)
Ref Sequence ENSEMBL: ENSMUSP00000083944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738]
Predicted Effect probably damaging
Transcript: ENSMUST00000086738
AA Change: D184G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: D184G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3s2 A T 7: 79,909,899 V94E probably damaging Het
Aven T A 2: 112,514,545 Y109* probably null Het
Cad T C 5: 31,060,573 S401P probably damaging Het
Ccdc122 A T 14: 77,092,776 I189F probably damaging Het
Cdkal1 A T 13: 29,777,215 probably null Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cnih4 C G 1: 181,162,183 F120L probably benign Het
Cpa2 T A 6: 30,550,732 probably null Het
Cpne5 T C 17: 29,226,216 D38G probably damaging Het
Dst GGAATCGTGCACTCGAA GGAA 1: 34,188,785 probably null Het
E330034G19Rik A G 14: 24,308,268 probably benign Het
Flrt1 A T 19: 7,096,465 I239N probably damaging Het
Foxb1 T A 9: 69,760,120 I43F probably damaging Het
Kcnq3 A G 15: 66,025,122 W310R probably damaging Het
Klrb1a A T 6: 128,618,610 D60E probably benign Het
Lbr A G 1: 181,816,964 probably null Het
Lsm8 T A 6: 18,851,673 I41N probably damaging Het
Mroh7 T C 4: 106,720,567 M305V possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr250 T C 9: 38,368,106 Y177H probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr481 T A 7: 108,081,116 F107L probably benign Het
Pcdhb5 A T 18: 37,321,155 D196V possibly damaging Het
Pcmt1 A G 10: 7,649,093 Y84H probably damaging Het
Pcnx2 A T 8: 125,860,958 I877K probably damaging Het
Pcsk5 A G 19: 17,575,831 Y662H probably benign Het
Prdx1 T A 4: 116,699,217 D187E probably benign Het
Ranbp2 T G 10: 58,479,076 Y1873D probably damaging Het
Rcor2 A T 19: 7,271,051 R144W probably damaging Het
Rptor T G 11: 119,756,249 I222S probably benign Het
Rrp8 C A 7: 105,733,401 R448L possibly damaging Het
Ryr2 A T 13: 11,601,805 I3909N probably damaging Het
Scn2a T G 2: 65,726,365 V1147G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Smox C T 2: 131,524,866 Q582* probably null Het
Sqor T A 2: 122,809,357 L180H possibly damaging Het
Stox2 T C 8: 47,191,890 D845G probably damaging Het
Szt2 T C 4: 118,392,905 I469V possibly damaging Het
Tcrg-C2 A G 13: 19,305,109 F151S possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tox C CTGGAGT 4: 6,688,835 probably benign Het
Upf2 T C 2: 6,027,301 V141A probably damaging Het
Usp54 A G 14: 20,565,057 L772P probably damaging Het
Vmn2r83 A T 10: 79,491,951 T798S possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp143 C T 7: 110,088,773 T473I probably damaging Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R0848:Cntnap5b UTSW 1 100255163 missense probably benign 0.22
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2069:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4329:Cntnap5b UTSW 1 100072163 missense probably damaging 0.99
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R5761:Cntnap5b UTSW 1 100446894 missense probably damaging 1.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6286:Cntnap5b UTSW 1 100255073 missense possibly damaging 0.82
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6336:Cntnap5b UTSW 1 100358669 missense probably benign 0.00
R6360:Cntnap5b UTSW 1 100431736 nonsense probably null
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense probably damaging 0.99
R7165:Cntnap5b UTSW 1 100076162 missense possibly damaging 0.94
R7190:Cntnap5b UTSW 1 100431849 splice site probably null
R7376:Cntnap5b UTSW 1 99967269 missense possibly damaging 0.92
R7385:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGTGCTGCCTACAAATGATTG -3'
(R):5'- TTACCCAAGTTCAGGTATAGGGC -3'

Sequencing Primer
(F):5'- GTGCTGCCTACAAATGATTGATTCC -3'
(R):5'- CCCAAGTTCAGGTATAGGGCTAGTC -3'
Posted On2016-11-08