Incidental Mutation 'R5653:Cc2d2a'
ID442095
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Namecoiled-coil and C2 domain containing 2A
Synonymsb2b1035Clo, 5730509K17Rik
MMRRC Submission 043299-MU
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R5653 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location43662346-43740972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43722462 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1127 (N1127S)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048150
AA Change: N1127S

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: N1127S

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125866
AA Change: N1073S

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: N1073S

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 T C 5: 35,883,412 L663P probably damaging Het
Atp10d A T 5: 72,264,067 Q682L probably benign Het
Atp8b1 A G 18: 64,545,197 V876A probably damaging Het
Bard1 A T 1: 71,031,429 V632E probably benign Het
Baz1b A T 5: 135,209,097 E209V probably benign Het
Bmp1 T A 14: 70,490,094 Y683F probably benign Het
Cacnb1 A T 11: 98,009,279 probably null Het
Capza2 G A 6: 17,654,113 A55T probably damaging Het
Ccdc13 A G 9: 121,798,787 *255R probably null Het
Ddias G T 7: 92,858,729 N659K probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dnah9 T C 11: 65,849,980 T4127A probably damaging Het
Dnajc10 T A 2: 80,349,368 Y749N probably damaging Het
Dnm1l A G 16: 16,319,489 L422P probably damaging Het
Edil3 A T 13: 89,131,812 N203I probably damaging Het
Egfr C T 11: 16,911,617 A1132V probably benign Het
Entpd7 C T 19: 43,691,157 R50* probably null Het
Fam160a1 A T 3: 85,722,501 L40Q probably damaging Het
Fat2 T C 11: 55,310,316 D644G probably damaging Het
Galnt11 T A 5: 25,248,858 D27E probably damaging Het
Gm10801 T A 2: 98,664,051 F158I probably damaging Het
Gm37240 A G 3: 84,497,795 F234L probably damaging Het
Gtf2ird1 A T 5: 134,410,967 F136L probably damaging Het
Hspa1l T C 17: 34,977,420 V145A probably damaging Het
Ice2 A G 9: 69,428,380 T882A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat6b A G 14: 21,669,372 N1264S probably benign Het
Kcnq4 C A 4: 120,702,411 V531L probably benign Het
Kif9 A T 9: 110,524,931 K790N probably damaging Het
Lipe T A 7: 25,398,408 I37L probably benign Het
Lrrc43 A G 5: 123,499,580 D270G probably damaging Het
Mon2 A G 10: 123,026,094 Y782H probably damaging Het
Mrpl52 T C 14: 54,427,229 S49P probably damaging Het
Olfr132 T A 17: 38,131,184 T3S possibly damaging Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Olfr477 A T 7: 107,990,385 T7S probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pcbp2 C T 15: 102,487,089 A141V probably damaging Het
Pcsk9 T A 4: 106,458,916 Y110F probably damaging Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Polq T A 16: 37,040,534 L506Q probably damaging Het
Prx C T 7: 27,517,604 P510L probably damaging Het
Ptpre T C 7: 135,653,943 F54L probably damaging Het
Rspry1 T G 8: 94,636,611 probably null Het
Tnfrsf11b A T 15: 54,259,866 L113Q probably damaging Het
Tnk1 C T 11: 69,853,585 G411S probably damaging Het
Tor3a A G 1: 156,656,510 L290S probably damaging Het
Tril T C 6: 53,817,985 T751A probably benign Het
Tubgcp6 C T 15: 89,108,612 V547I possibly damaging Het
Txnrd3 T C 6: 89,654,085 L121P probably benign Het
Vmn1r210 T A 13: 22,827,208 R303* probably null Het
Vmn2r38 T C 7: 9,097,765 M1V probably null Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43740828 missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43735395 missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R5912:Cc2d2a UTSW 5 43720430 missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43709113 missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43704074 missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7071:Cc2d2a UTSW 5 43709113 missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43683139 missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43729990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGTTTTACTTTGCCTGAGATAG -3'
(R):5'- TTTGGCCTGTAAGAAGTCAGAGAC -3'

Sequencing Primer
(F):5'- CTTTGCCTGAGATAGAAAATGTTCAC -3'
(R):5'- GACTGGCCTGGAACTTACTACATAG -3'
Posted On2016-11-09