Incidental Mutation 'R5653:Baz1b'
ID442100
Institutional Source Beutler Lab
Gene Symbol Baz1b
Ensembl Gene ENSMUSG00000002748
Gene Namebromodomain adjacent to zinc finger domain, 1B
SynonymsWSTF, Wbscr9
MMRRC Submission 043299-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5653 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location135187264-135246129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135209097 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 209 (E209V)
Ref Sequence ENSEMBL: ENSMUSP00000002825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825]
Predicted Effect probably benign
Transcript: ENSMUST00000002825
AA Change: E209V

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748
AA Change: E209V

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176793
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bromodomain protein family. The bromodomain is a structural motif characteristic of proteins involved in chromatin-dependent regulation of transcription. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality by P2, small size at birth, impaired double strand DNA repair, and heart defects. Mice heterozygous for a null allele exhibit hypercalcemia and heart defects. Mice homozygous for an ENU mutation exhibit craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 T C 5: 35,883,412 L663P probably damaging Het
Atp10d A T 5: 72,264,067 Q682L probably benign Het
Atp8b1 A G 18: 64,545,197 V876A probably damaging Het
Bard1 A T 1: 71,031,429 V632E probably benign Het
Bmp1 T A 14: 70,490,094 Y683F probably benign Het
Cacnb1 A T 11: 98,009,279 probably null Het
Capza2 G A 6: 17,654,113 A55T probably damaging Het
Cc2d2a A G 5: 43,722,462 N1127S possibly damaging Het
Ccdc13 A G 9: 121,798,787 *255R probably null Het
Ddias G T 7: 92,858,729 N659K probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dnah9 T C 11: 65,849,980 T4127A probably damaging Het
Dnajc10 T A 2: 80,349,368 Y749N probably damaging Het
Dnm1l A G 16: 16,319,489 L422P probably damaging Het
Edil3 A T 13: 89,131,812 N203I probably damaging Het
Egfr C T 11: 16,911,617 A1132V probably benign Het
Entpd7 C T 19: 43,691,157 R50* probably null Het
Fam160a1 A T 3: 85,722,501 L40Q probably damaging Het
Fat2 T C 11: 55,310,316 D644G probably damaging Het
Galnt11 T A 5: 25,248,858 D27E probably damaging Het
Gm10801 T A 2: 98,664,051 F158I probably damaging Het
Gm37240 A G 3: 84,497,795 F234L probably damaging Het
Gtf2ird1 A T 5: 134,410,967 F136L probably damaging Het
Hspa1l T C 17: 34,977,420 V145A probably damaging Het
Ice2 A G 9: 69,428,380 T882A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kat6b A G 14: 21,669,372 N1264S probably benign Het
Kcnq4 C A 4: 120,702,411 V531L probably benign Het
Kif9 A T 9: 110,524,931 K790N probably damaging Het
Lipe T A 7: 25,398,408 I37L probably benign Het
Lrrc43 A G 5: 123,499,580 D270G probably damaging Het
Mon2 A G 10: 123,026,094 Y782H probably damaging Het
Mrpl52 T C 14: 54,427,229 S49P probably damaging Het
Olfr132 T A 17: 38,131,184 T3S possibly damaging Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr318 G A 11: 58,720,251 H266Y probably damaging Het
Olfr477 A T 7: 107,990,385 T7S probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pcbp2 C T 15: 102,487,089 A141V probably damaging Het
Pcsk9 T A 4: 106,458,916 Y110F probably damaging Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Polq T A 16: 37,040,534 L506Q probably damaging Het
Prx C T 7: 27,517,604 P510L probably damaging Het
Ptpre T C 7: 135,653,943 F54L probably damaging Het
Rspry1 T G 8: 94,636,611 probably null Het
Tnfrsf11b A T 15: 54,259,866 L113Q probably damaging Het
Tnk1 C T 11: 69,853,585 G411S probably damaging Het
Tor3a A G 1: 156,656,510 L290S probably damaging Het
Tril T C 6: 53,817,985 T751A probably benign Het
Tubgcp6 C T 15: 89,108,612 V547I possibly damaging Het
Txnrd3 T C 6: 89,654,085 L121P probably benign Het
Vmn1r210 T A 13: 22,827,208 R303* probably null Het
Vmn2r38 T C 7: 9,097,765 M1V probably null Het
Other mutations in Baz1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Baz1b APN 5 135216590 missense probably damaging 0.99
IGL00589:Baz1b APN 5 135196492 missense possibly damaging 0.50
IGL00736:Baz1b APN 5 135240032 missense probably damaging 1.00
IGL02053:Baz1b APN 5 135242466 missense probably benign 0.00
IGL02197:Baz1b APN 5 135209097 missense probably benign 0.20
IGL02236:Baz1b APN 5 135217284 missense probably damaging 1.00
IGL02351:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02358:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02424:Baz1b APN 5 135217979 missense probably damaging 1.00
IGL03051:Baz1b APN 5 135217225 missense probably benign 0.02
PIT4480001:Baz1b UTSW 5 135217965 missense probably damaging 1.00
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0365:Baz1b UTSW 5 135240131 missense probably benign 0.00
R0655:Baz1b UTSW 5 135242430 missense probably benign 0.00
R0698:Baz1b UTSW 5 135198221 missense probably damaging 1.00
R0959:Baz1b UTSW 5 135244222 missense probably damaging 1.00
R1411:Baz1b UTSW 5 135230323 missense possibly damaging 0.73
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1511:Baz1b UTSW 5 135217782 missense probably damaging 1.00
R1557:Baz1b UTSW 5 135218243 missense possibly damaging 0.94
R1674:Baz1b UTSW 5 135205111 missense probably damaging 1.00
R1760:Baz1b UTSW 5 135242524 missense probably benign
R1951:Baz1b UTSW 5 135216739 missense probably benign 0.11
R2058:Baz1b UTSW 5 135217225 missense probably benign 0.02
R2060:Baz1b UTSW 5 135205114 missense probably damaging 1.00
R2142:Baz1b UTSW 5 135217275 missense probably damaging 1.00
R2496:Baz1b UTSW 5 135210775 missense probably damaging 1.00
R4088:Baz1b UTSW 5 135216940 missense probably damaging 0.96
R4397:Baz1b UTSW 5 135244446 missense probably damaging 1.00
R4784:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R4785:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R5386:Baz1b UTSW 5 135238059 missense probably damaging 1.00
R5808:Baz1b UTSW 5 135221958 missense probably benign 0.00
R6010:Baz1b UTSW 5 135217451 missense possibly damaging 0.82
R6014:Baz1b UTSW 5 135217394 missense probably damaging 1.00
R6173:Baz1b UTSW 5 135242507 missense probably benign
R6194:Baz1b UTSW 5 135243890 missense probably damaging 0.99
R6419:Baz1b UTSW 5 135242494 missense probably benign
R6435:Baz1b UTSW 5 135237945 missense probably damaging 1.00
R7078:Baz1b UTSW 5 135217439 missense probably benign 0.04
R7341:Baz1b UTSW 5 135223116 missense probably damaging 1.00
X0027:Baz1b UTSW 5 135216892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTACCTGATTTCCTGCATAGAC -3'
(R):5'- AATCTCTGTGGTGAGGACATTCC -3'

Sequencing Primer
(F):5'- TGCATAGACTAGCTCGTGGAAGTTAC -3'
(R):5'- GGACATTCCTTGACATATTCCTTAG -3'
Posted On2016-11-09