Incidental Mutation 'R5654:Ipo9'
ID442147
Institutional Source Beutler Lab
Gene Symbol Ipo9
Ensembl Gene ENSMUSG00000041879
Gene Nameimportin 9
Synonyms
MMRRC Submission 043300-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location135382312-135430499 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 135385472 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1006 (Y1006*)
Ref Sequence ENSEMBL: ENSMUSP00000036093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041023] [ENSMUST00000161032] [ENSMUST00000161189]
Predicted Effect probably null
Transcript: ENSMUST00000041023
AA Change: Y1006*
SMART Domains Protein: ENSMUSP00000036093
Gene: ENSMUSG00000041879
AA Change: Y1006*

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
low complexity region 911 922 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159487
Predicted Effect probably benign
Transcript: ENSMUST00000161032
SMART Domains Protein: ENSMUSP00000124779
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161189
SMART Domains Protein: ENSMUSP00000124492
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
SCOP:d1i6la_ 21 52 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161750
Predicted Effect unknown
Transcript: ENSMUST00000161934
AA Change: S150T
SMART Domains Protein: ENSMUSP00000124210
Gene: ENSMUSG00000041879
AA Change: S150T

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162858
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Ipo9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Ipo9 APN 1 135400059 missense probably damaging 1.00
IGL01611:Ipo9 APN 1 135386693 missense possibly damaging 0.76
IGL01941:Ipo9 APN 1 135408073 missense possibly damaging 0.95
IGL01944:Ipo9 APN 1 135405886 missense probably damaging 0.98
IGL01959:Ipo9 APN 1 135420355 critical splice acceptor site probably null
IGL02649:Ipo9 APN 1 135385934 missense possibly damaging 0.92
IGL02697:Ipo9 APN 1 135390576 missense probably benign 0.00
IGL03286:Ipo9 APN 1 135407078 intron probably benign
FR4304:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4304:Ipo9 UTSW 1 135386279 nonsense probably null
FR4340:Ipo9 UTSW 1 135386269 small insertion probably benign
FR4340:Ipo9 UTSW 1 135386271 small insertion probably benign
FR4548:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386266 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386281 small insertion probably benign
FR4976:Ipo9 UTSW 1 135386281 small insertion probably benign
R0111:Ipo9 UTSW 1 135405924 missense probably damaging 0.97
R0238:Ipo9 UTSW 1 135404336 splice site probably benign
R0239:Ipo9 UTSW 1 135404336 splice site probably benign
R0279:Ipo9 UTSW 1 135420363 intron probably benign
R0704:Ipo9 UTSW 1 135386268 small deletion probably benign
R1070:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1282:Ipo9 UTSW 1 135402292 missense possibly damaging 0.48
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1728:Ipo9 UTSW 1 135386268 small insertion probably benign
R1728:Ipo9 UTSW 1 135386271 small insertion probably benign
R1728:Ipo9 UTSW 1 135402250 missense probably benign
R1729:Ipo9 UTSW 1 135386268 small insertion probably benign
R1729:Ipo9 UTSW 1 135402250 missense probably benign
R1730:Ipo9 UTSW 1 135386268 small insertion probably benign
R1730:Ipo9 UTSW 1 135402250 missense probably benign
R1739:Ipo9 UTSW 1 135386268 small insertion probably benign
R1739:Ipo9 UTSW 1 135402250 missense probably benign
R1762:Ipo9 UTSW 1 135386268 small insertion probably benign
R1762:Ipo9 UTSW 1 135402250 missense probably benign
R1783:Ipo9 UTSW 1 135386268 small insertion probably benign
R1783:Ipo9 UTSW 1 135402250 missense probably benign
R1784:Ipo9 UTSW 1 135386268 small insertion probably benign
R1784:Ipo9 UTSW 1 135402250 missense probably benign
R1785:Ipo9 UTSW 1 135386268 small insertion probably benign
R1785:Ipo9 UTSW 1 135386281 small insertion probably benign
R1785:Ipo9 UTSW 1 135402250 missense probably benign
R1899:Ipo9 UTSW 1 135400146 missense probably damaging 0.99
R2049:Ipo9 UTSW 1 135386268 small insertion probably benign
R2049:Ipo9 UTSW 1 135402250 missense probably benign
R2130:Ipo9 UTSW 1 135386268 small insertion probably benign
R2130:Ipo9 UTSW 1 135402250 missense probably benign
R2131:Ipo9 UTSW 1 135386268 small insertion probably benign
R2131:Ipo9 UTSW 1 135402250 missense probably benign
R2133:Ipo9 UTSW 1 135386268 small insertion probably benign
R2133:Ipo9 UTSW 1 135386275 small insertion probably benign
R2133:Ipo9 UTSW 1 135402250 missense probably benign
R2136:Ipo9 UTSW 1 135394285 missense probably damaging 0.98
R2141:Ipo9 UTSW 1 135386268 small insertion probably benign
R2141:Ipo9 UTSW 1 135402250 missense probably benign
R2142:Ipo9 UTSW 1 135386268 small insertion probably benign
R2142:Ipo9 UTSW 1 135386275 small insertion probably benign
R2142:Ipo9 UTSW 1 135386282 small insertion probably benign
R2142:Ipo9 UTSW 1 135402250 missense probably benign
R2356:Ipo9 UTSW 1 135406817 missense probably benign 0.00
R2923:Ipo9 UTSW 1 135400129 missense probably benign 0.25
R3161:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R4086:Ipo9 UTSW 1 135388690 unclassified probably benign
R4679:Ipo9 UTSW 1 135394169 missense probably benign
R4816:Ipo9 UTSW 1 135406550 missense probably benign 0.21
R4956:Ipo9 UTSW 1 135404222 critical splice donor site probably null
R5052:Ipo9 UTSW 1 135388611 unclassified probably null
R5055:Ipo9 UTSW 1 135402359 nonsense probably null
R5230:Ipo9 UTSW 1 135420070 missense probably damaging 1.00
R5240:Ipo9 UTSW 1 135389606 unclassified probably benign
R5257:Ipo9 UTSW 1 135385435 missense probably damaging 1.00
R5340:Ipo9 UTSW 1 135385432 missense probably benign 0.00
R5560:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5602:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5604:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R6018:Ipo9 UTSW 1 135390536 critical splice donor site probably null
R6128:Ipo9 UTSW 1 135390573 missense possibly damaging 0.90
R6841:Ipo9 UTSW 1 135386308 missense probably benign
Y5405:Ipo9 UTSW 1 135386269 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386275 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386284 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGCATCTCAAGGCCAGAG -3'
(R):5'- AAAGTTCTCTGGGTGGAATAGG -3'

Sequencing Primer
(F):5'- CCAGAGAGGGCGGTAGAATGTTC -3'
(R):5'- GGGTTCCCTATAGCATTCTGTCACG -3'
Posted On2016-11-09