Incidental Mutation 'R5654:Klhl32'
ID442159
Institutional Source Beutler Lab
Gene Symbol Klhl32
Ensembl Gene ENSMUSG00000040387
Gene Namekelch-like 32
SynonymsLOC384000, D4Ertd389e, 6430524H05Rik
MMRRC Submission 043300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location24612554-24851124 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 24800805 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084781] [ENSMUST00000108214] [ENSMUST00000108218] [ENSMUST00000140652]
Predicted Effect probably null
Transcript: ENSMUST00000084781
SMART Domains Protein: ENSMUSP00000081839
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 138 1.28e-22 SMART
BACK 111 212 3.17e-22 SMART
Kelch 257 313 4.07e-1 SMART
Kelch 314 365 3.57e-1 SMART
Kelch 366 413 3.77e-4 SMART
Kelch 414 461 7.04e-4 SMART
Kelch 462 514 6.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108213
Predicted Effect probably null
Transcript: ENSMUST00000108214
SMART Domains Protein: ENSMUSP00000103849
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 225 3.31e-2 SMART
Blast:Kelch 233 285 1e-31 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000108218
SMART Domains Protein: ENSMUSP00000103853
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 245 3.17e-22 SMART
Kelch 290 346 4.07e-1 SMART
Kelch 347 398 3.57e-1 SMART
Kelch 399 446 3.77e-4 SMART
Kelch 447 494 7.04e-4 SMART
Kelch 495 547 6.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140652
SMART Domains Protein: ENSMUSP00000137312
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 139 2.14e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142373
Meta Mutation Damage Score 0.686 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Klhl32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Klhl32 APN 4 24682245 missense probably damaging 1.00
IGL02293:Klhl32 APN 4 24626935 missense probably damaging 1.00
IGL02374:Klhl32 APN 4 24743856 critical splice donor site probably null
IGL02824:Klhl32 APN 4 24682237 nonsense probably null
IGL03211:Klhl32 APN 4 24792616 critical splice donor site probably null
IGL03374:Klhl32 APN 4 24649533 intron probably benign
R0071:Klhl32 UTSW 4 24743907 missense probably damaging 0.98
R0478:Klhl32 UTSW 4 24792777 missense probably damaging 1.00
R0856:Klhl32 UTSW 4 24682092 missense probably damaging 1.00
R0908:Klhl32 UTSW 4 24682092 missense probably damaging 1.00
R1882:Klhl32 UTSW 4 24743916 nonsense probably null
R1927:Klhl32 UTSW 4 24617474 missense probably benign 0.00
R2137:Klhl32 UTSW 4 24629275 nonsense probably null
R3176:Klhl32 UTSW 4 24682063 missense probably benign 0.39
R3276:Klhl32 UTSW 4 24682063 missense probably benign 0.39
R4059:Klhl32 UTSW 4 24792781 missense probably damaging 1.00
R4246:Klhl32 UTSW 4 24800822 missense possibly damaging 0.50
R4597:Klhl32 UTSW 4 24629339 missense probably benign 0.21
R4801:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4802:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4929:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
R6039:Klhl32 UTSW 4 24792615 critical splice donor site probably null
R6039:Klhl32 UTSW 4 24792615 critical splice donor site probably null
R6362:Klhl32 UTSW 4 24629195 missense probably null 1.00
R6490:Klhl32 UTSW 4 24711578 intron probably benign
R6948:Klhl32 UTSW 4 24629250 missense probably benign 0.00
R6981:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAGGTCTTAGTGGTTCATCC -3'
(R):5'- TGCTACTGGTGTCATGAGC -3'

Sequencing Primer
(F):5'- CAAATCGTGCTCAGTTCGAG -3'
(R):5'- CTGGTGTCATGAGCTTCTAGAATAC -3'
Posted On2016-11-09