Incidental Mutation 'R5654:Slc5a1'
ID442160
Institutional Source Beutler Lab
Gene Symbol Slc5a1
Ensembl Gene ENSMUSG00000011034
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 1
SynonymsSglt1, sodium glucose cotransporter 1
MMRRC Submission 043300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33104219-33162870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33146611 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 257 (T257A)
Ref Sequence ENSEMBL: ENSMUSP00000011178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011178]
Predicted Effect probably benign
Transcript: ENSMUST00000011178
AA Change: T257A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000011178
Gene: ENSMUSG00000011034
AA Change: T257A

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 2.6e-174 PFAM
transmembrane domain 526 548 N/A INTRINSIC
low complexity region 620 634 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202802
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-dependent glucose transporter (SGLT) family. The encoded integral membrane protein is the primary mediator of dietary glucose and galactose uptake from the intestinal lumen. Mutations in this gene have been associated with glucose-galactose malabsorption. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality unless maintained on a glucose-galatose-free diet, distended intestine, impaired glucose transport across the brush border membrane and impaired renal glucose reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Slc5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Slc5a1 APN 5 33160865 missense probably benign
IGL01872:Slc5a1 APN 5 33154637 missense probably damaging 0.97
IGL01906:Slc5a1 APN 5 33154653 missense probably damaging 1.00
IGL02614:Slc5a1 APN 5 33154601 missense probably benign 0.02
IGL03241:Slc5a1 APN 5 33133405 missense probably benign 0.00
IGL03336:Slc5a1 APN 5 33146943 missense probably benign 0.24
R0314:Slc5a1 UTSW 5 33146651 missense probably benign 0.02
R0421:Slc5a1 UTSW 5 33134652 missense probably damaging 1.00
R0755:Slc5a1 UTSW 5 33133389 missense probably benign 0.14
R0791:Slc5a1 UTSW 5 33158077 splice site probably benign
R1506:Slc5a1 UTSW 5 33154708 missense possibly damaging 0.72
R1801:Slc5a1 UTSW 5 33146953 missense probably damaging 1.00
R2143:Slc5a1 UTSW 5 33160796 missense probably benign
R2190:Slc5a1 UTSW 5 33104593 critical splice donor site probably null
R3796:Slc5a1 UTSW 5 33152652 missense probably damaging 1.00
R4423:Slc5a1 UTSW 5 33154674 missense possibly damaging 0.49
R4465:Slc5a1 UTSW 5 33146516 missense possibly damaging 0.89
R4588:Slc5a1 UTSW 5 33145288 missense probably benign 0.01
R4722:Slc5a1 UTSW 5 33146711 missense possibly damaging 0.86
R4826:Slc5a1 UTSW 5 33159150 missense probably benign
R4934:Slc5a1 UTSW 5 33104514 missense probably benign
R4955:Slc5a1 UTSW 5 33160902 missense probably benign 0.02
R4963:Slc5a1 UTSW 5 33160782 missense probably benign 0.00
R5008:Slc5a1 UTSW 5 33152573 missense possibly damaging 0.75
R5094:Slc5a1 UTSW 5 33158280 missense probably damaging 1.00
R5292:Slc5a1 UTSW 5 33158241 missense probably benign
R6784:Slc5a1 UTSW 5 33158116 missense probably benign 0.00
X0064:Slc5a1 UTSW 5 33134636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGCAGGGAAGATAATTTGTCC -3'
(R):5'- ACAGGTGGGAGTCTTGATCATG -3'

Sequencing Primer
(F):5'- GGGAAGATAATTTGTCCCAAACC -3'
(R):5'- GGGAGTCTTGATCATGCATCCC -3'
Posted On2016-11-09