Incidental Mutation 'R5654:Rpl5'
ID442161
Institutional Source Beutler Lab
Gene Symbol Rpl5
Ensembl Gene ENSMUSG00000058558
Gene Nameribosomal protein L5
SynonymsU21RNA
MMRRC Submission 043300-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107900502-107909005 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 107903648 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031198] [ENSMUST00000082223] [ENSMUST00000153590]
Predicted Effect probably benign
Transcript: ENSMUST00000031198
SMART Domains Protein: ENSMUSP00000031198
Gene: ENSMUSG00000029270

DomainStartEndE-ValueType
PIP49_N 19 177 1.7e-92 SMART
Pfam:PIP49_C 194 396 1.9e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082223
SMART Domains Protein: ENSMUSP00000080854
Gene: ENSMUSG00000058558

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
Pfam:Ribosomal_L18p 26 173 2.1e-46 PFAM
Pfam:Ribosomal_L18_c 192 283 2.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151767
Predicted Effect probably benign
Transcript: ENSMUST00000153590
SMART Domains Protein: ENSMUSP00000123474
Gene: ENSMUSG00000058558

DomainStartEndE-ValueType
Pfam:Ribosomal_L18p 1 123 6.3e-37 PFAM
Pfam:Ribosomal_L18_c 142 163 2.7e-8 PFAM
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L18P family of ribosomal proteins. It is located in the cytoplasm. The protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The protein interacts specifically with the beta subunit of casein kinase II. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Rpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rpl5 APN 5 107907279 critical splice donor site probably null
IGL01694:Rpl5 APN 5 107907240 missense probably benign 0.00
PIT4142001:Rpl5 UTSW 5 107907183 unclassified probably benign
R0070:Rpl5 UTSW 5 107901900 missense probably benign 0.13
R0153:Rpl5 UTSW 5 107904757 missense probably benign 0.00
R3877:Rpl5 UTSW 5 107903801 missense probably benign 0.14
R4502:Rpl5 UTSW 5 107904857 missense possibly damaging 0.92
R4503:Rpl5 UTSW 5 107904857 missense possibly damaging 0.92
R6955:Rpl5 UTSW 5 107902046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCATCAGCAGGGAACATGG -3'
(R):5'- GGATAGACAAGCCTCCATCC -3'

Sequencing Primer
(F):5'- CAGCAGGGAACATGGTTTTATCAGTC -3'
(R):5'- CTTCAGGGCCCCAAAAACTTTATTG -3'
Posted On2016-11-09