Mutagenetix > Incidental Mutation

Incidental Mutation 'R5654:Rpl5'

442161

Institutional Source

Beutler Lab

Gene Symbol

Rpl5

Ensembl Gene

ENSMUSG00000058558

Gene Name

ribosomal protein L5

Synonyms

U21RNA, Skax23, Ska23, Ska

MMRRC Submission

043300-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R5654 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108048388-108056871 bp(+) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 108051514 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031198] [ENSMUST00000082223] [ENSMUST00000153590]

AlphaFold

P47962

Predicted Effect

probably benign
Transcript: ENSMUST00000031198

SMART Domains

Protein: ENSMUSP00000031198
Gene: ENSMUSG00000029270

Domain	Start	End	E-Value	Type
PIP49_N	19	177	1.7e-92	SMART
Pfam:PIP49_C	194	396	1.9e-69	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000082223

SMART Domains

Protein: ENSMUSP00000080854
Gene: ENSMUSG00000058558

Domain	Start	End	E-Value	Type
low complexity region	19	24	N/A	INTRINSIC
Pfam:Ribosomal_L18p	26	173	2.1e-46	PFAM
Pfam:Ribosomal_L18_c	192	283	2.2e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104238

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123183

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129944

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140659

Predicted Effect

probably benign
Transcript: ENSMUST00000153590

SMART Domains

Protein: ENSMUSP00000123474
Gene: ENSMUSG00000058558

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18p	1	123	6.3e-37	PFAM
Pfam:Ribosomal_L18_c	142	163	2.7e-8	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L18P family of ribosomal proteins. It is located in the cytoplasm. The protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The protein interacts specifically with the beta subunit of casein kinase II. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb6	T	C	1: 75,151,479 (GRCm39)		probably null	Het
Abcc9	G	A	6: 142,571,371 (GRCm39)		probably benign	Het
Acss2	T	C	2: 155,416,575 (GRCm39)		probably benign	Het
Atp8b4	G	A	2: 126,217,725 (GRCm39)	T597I	probably damaging	Het
Btaf1	A	T	19: 36,961,015 (GRCm39)	N796I	probably benign	Het
Caskin2	T	C	11: 115,690,905 (GRCm39)		probably null	Het
Cdhr2	A	G	13: 54,884,349 (GRCm39)	N1295D	probably benign	Het
Cog3	G	A	14: 75,962,239 (GRCm39)	T534M	probably benign	Het
Cpne1	A	G	2: 155,919,561 (GRCm39)	S303P	probably damaging	Het
Cs	G	A	10: 128,187,086 (GRCm39)	G74S	possibly damaging	Het
Cyb5r4	G	T	9: 86,929,533 (GRCm39)	S229I	probably damaging	Het
Ddr1	C	T	17: 35,997,400 (GRCm39)	A531T	probably benign	Het
Ect2l	C	T	10: 18,018,810 (GRCm39)	V529M	probably damaging	Het
Edaradd	C	A	13: 12,493,161 (GRCm39)	R177L	possibly damaging	Het
Esf1	T	C	2: 140,006,148 (GRCm39)	D333G	possibly damaging	Het
Fam8a1	T	A	13: 46,827,814 (GRCm39)	L334H	probably damaging	Het
Fbxl18	A	G	5: 142,871,558 (GRCm39)	I559T	probably damaging	Het
Fcrl2	A	C	3: 87,164,851 (GRCm39)	V225G	probably benign	Het
Ido1	C	T	8: 25,077,819 (GRCm39)	V83M	probably damaging	Het
Iffo1	T	G	6: 125,130,030 (GRCm39)	C419G	probably damaging	Het
Igfals	A	T	17: 25,100,439 (GRCm39)	Y510F	probably benign	Het
Ipo9	A	T	1: 135,313,210 (GRCm39)	Y1006*	probably null	Het
Itgb4	C	T	11: 115,874,983 (GRCm39)	R447W	probably benign	Het
Jmjd1c	T	A	10: 67,065,785 (GRCm39)	S1737T	probably benign	Het
Klhl32	C	T	4: 24,800,805 (GRCm39)		probably null	Het
Klk1b11	T	A	7: 43,427,810 (GRCm39)	C173S	probably damaging	Het
Klk1b24	A	T	7: 43,840,889 (GRCm39)	M106L	probably benign	Het
Lamp1	G	A	8: 13,221,388 (GRCm39)		probably null	Het
Mapk4	A	T	18: 74,103,365 (GRCm39)	V48E	probably damaging	Het
Marchf6	A	T	15: 31,486,082 (GRCm39)	D395E	probably damaging	Het
Mdp1	A	G	14: 55,896,465 (GRCm39)	F157S	probably damaging	Het
Mettl21e	A	T	1: 44,250,255 (GRCm39)	F50L	probably damaging	Het
Mrgpra2a	A	G	7: 47,077,153 (GRCm39)	I35T	probably benign	Het
Natd1	T	C	11: 60,796,892 (GRCm39)	Y91C	probably damaging	Het
Nbas	T	A	12: 13,633,476 (GRCm39)	Y2294N	probably damaging	Het
Nrcam	A	G	12: 44,610,841 (GRCm39)	T520A	probably benign	Het
Nrf1	A	G	6: 30,117,061 (GRCm39)	T324A	probably benign	Het
Or10a2	G	A	7: 106,673,394 (GRCm39)	A120T	probably damaging	Het
Or4k51	T	A	2: 111,585,326 (GRCm39)	I244N	probably damaging	Het
Or52a5	A	C	7: 103,427,182 (GRCm39)	D123E	probably damaging	Het
Or5m11b	A	G	2: 85,806,500 (GRCm39)	I304M	probably benign	Het
Pam	C	T	1: 97,792,123 (GRCm39)	V433I	probably benign	Het
Pck1	T	A	2: 173,000,353 (GRCm39)	Y595N	probably damaging	Het
Per2	C	T	1: 91,373,223 (GRCm39)		probably null	Het
Piezo2	G	C	18: 63,278,162 (GRCm39)	F247L	possibly damaging	Het
Pkdcc	A	G	17: 83,523,337 (GRCm39)	Y148C	probably damaging	Het
Plod2	A	G	9: 92,475,876 (GRCm39)	T320A	probably benign	Het
Ppip5k1	G	A	2: 121,147,157 (GRCm39)	R1155C	probably benign	Het
Ppp1r15b	C	T	1: 133,059,382 (GRCm39)		probably benign	Het
Prkn	C	T	17: 11,456,536 (GRCm39)	A119V	probably damaging	Het
Ptprz1	G	T	6: 22,986,133 (GRCm39)	C311F	probably damaging	Het
Rab11fip3	A	T	17: 26,235,038 (GRCm39)	V44E	probably damaging	Het
Rttn	G	A	18: 89,066,556 (GRCm39)	V1201I	probably benign	Het
Sdk1	A	G	5: 141,921,853 (GRCm39)	N283S	probably damaging	Het
Shank3	T	A	15: 89,405,529 (GRCm39)	N418K	probably benign	Het
Shmt2	T	C	10: 127,353,668 (GRCm39)	D499G	probably benign	Het
Slc25a46	A	G	18: 31,716,293 (GRCm39)	L403S	probably damaging	Het
Slc5a1	A	G	5: 33,303,955 (GRCm39)	T257A	probably benign	Het
Snrnp35	T	C	5: 124,628,535 (GRCm39)	V116A	probably benign	Het
Spag9	T	A	11: 93,981,538 (GRCm39)	F593I	probably damaging	Het
Tmem171	C	A	13: 98,828,574 (GRCm39)	R192L	probably benign	Het
Trappc3l	T	A	10: 33,978,703 (GRCm39)	L169Q	unknown	Het
Ube2s	T	C	7: 4,811,431 (GRCm39)	E148G	probably damaging	Het
Uspl1	T	C	5: 149,146,521 (GRCm39)	F424S	probably damaging	Het
Vmn1r2	T	C	4: 3,172,261 (GRCm39)	V60A	probably benign	Het
Wdfy4	T	C	14: 32,829,575 (GRCm39)		probably null	Het
Zfp735	C	T	11: 73,602,964 (GRCm39)	S636L	possibly damaging	Het
Zswim9	G	A	7: 12,995,094 (GRCm39)	S354F	probably damaging	Het

Other mutations in Rpl5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Rpl5	APN	5	108,055,145 (GRCm39)	critical splice donor site	probably null
IGL01694:Rpl5	APN	5	108,055,106 (GRCm39)	missense	probably benign	0.00
PIT4142001:Rpl5	UTSW	5	108,055,049 (GRCm39)	unclassified	probably benign
R0070:Rpl5	UTSW	5	108,049,766 (GRCm39)	missense	probably benign	0.13
R0153:Rpl5	UTSW	5	108,052,623 (GRCm39)	missense	probably benign	0.00
R3877:Rpl5	UTSW	5	108,051,667 (GRCm39)	missense	probably benign	0.14
R4502:Rpl5	UTSW	5	108,052,723 (GRCm39)	missense	possibly damaging	0.92
R4503:Rpl5	UTSW	5	108,052,723 (GRCm39)	missense	possibly damaging	0.92
R6955:Rpl5	UTSW	5	108,049,912 (GRCm39)	missense	probably benign	0.01
R9536:Rpl5	UTSW	5	108,051,721 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTCATCAGCAGGGAACATGG -3'
(R):5'- GGATAGACAAGCCTCCATCC -3'

Sequencing Primer
(F):5'- CAGCAGGGAACATGGTTTTATCAGTC -3'
(R):5'- CTTCAGGGCCCCAAAAACTTTATTG -3'

Posted On

2016-11-09