Incidental Mutation 'R5654:Klk1b24'
ID442173
Institutional Source Beutler Lab
Gene Symbol Klk1b24
Ensembl Gene ENSMUSG00000063713
Gene Namekallikrein 1-related peptidase b24
SynonymsmGk-24, Klk24
MMRRC Submission 043300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.032) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44188236-44192455 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44191465 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 106 (M106L)
Ref Sequence ENSEMBL: ENSMUSP00000073392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073713]
Predicted Effect probably benign
Transcript: ENSMUST00000073713
AA Change: M106L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073392
Gene: ENSMUSG00000063713
AA Change: M106L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 255 1.22e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206937
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Klk1b24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Klk1b24 APN 7 44191633 missense probably damaging 0.96
IGL02394:Klk1b24 APN 7 44191870 missense possibly damaging 0.65
IGL02500:Klk1b24 APN 7 44188324 splice site probably benign
IGL03030:Klk1b24 APN 7 44191366 missense probably benign
R1458:Klk1b24 UTSW 7 44191466 missense possibly damaging 0.49
R1465:Klk1b24 UTSW 7 44191361 missense probably benign 0.24
R1465:Klk1b24 UTSW 7 44191361 missense probably benign 0.24
R1714:Klk1b24 UTSW 7 44191515 missense probably damaging 1.00
R1771:Klk1b24 UTSW 7 44188229 unclassified probably null
R1791:Klk1b24 UTSW 7 44190428 splice site probably null
R3690:Klk1b24 UTSW 7 44191819 missense probably benign
R4726:Klk1b24 UTSW 7 44190396 missense probably damaging 1.00
R5883:Klk1b24 UTSW 7 44190363 missense probably benign 0.00
R6775:Klk1b24 UTSW 7 44191465 missense probably benign 0.05
R7083:Klk1b24 UTSW 7 44191801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTCTCATGCCTACCC -3'
(R):5'- TGGGTGTAATGCTGCCCCA -3'

Sequencing Primer
(F):5'- CTGACTCCTTATGTATGCATGTATG -3'
(R):5'- ATCTGTGATGTCAGCAGG -3'
Posted On2016-11-09