Incidental Mutation 'R5654:Zfp735'
ID442187
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Namezinc finger protein 735
Synonyms1700012C15Rik
MMRRC Submission 043300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73688778-73713798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73712138 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 636 (S636L)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080407
AA Change: S636L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: S636L

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149560
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1421:Zfp735 UTSW 11 73710697 missense probably benign
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R1931:Zfp735 UTSW 11 73711851 missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711397 nonsense probably null
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73711652 missense probably benign 0.33
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73711054 missense probably benign 0.08
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CAGTACTCAGCTCTTCAAAACC -3'
(R):5'- AATCATGTAAATGATTCCCCATGC -3'

Sequencing Primer
(F):5'- GGGGAATCATTTATGCAGTCATC -3'
(R):5'- AGATCTGAGCACTGTCTAAAGC -3'
Posted On2016-11-09