Incidental Mutation 'R5654:Caskin2'
ID442189
Institutional Source Beutler Lab
Gene Symbol Caskin2
Ensembl Gene ENSMUSG00000034471
Gene NameCASK-interacting protein 2
Synonyms1600028L06Rik
MMRRC Submission 043300-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115799183-115813639 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 115800079 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041684] [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000132780]
Predicted Effect probably null
Transcript: ENSMUST00000041684
SMART Domains Protein: ENSMUSP00000041328
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
ANK 114 143 1.4e-4 SMART
ANK 147 176 3.26e0 SMART
ANK 188 217 3.33e-6 SMART
ANK 220 249 4.82e-3 SMART
SH3 284 346 1.13e-6 SMART
SAM 485 551 8.53e-12 SMART
SAM 554 621 1.41e-12 SMART
low complexity region 762 774 N/A INTRINSIC
Pfam:Caskin-Pro-rich 793 883 1.4e-32 PFAM
low complexity region 904 921 N/A INTRINSIC
low complexity region 925 944 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1042 1069 N/A INTRINSIC
low complexity region 1084 1090 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
Pfam:Caskin-tail 1144 1201 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093912
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103033
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125658
Predicted Effect probably benign
Transcript: ENSMUST00000132780
SMART Domains Protein: ENSMUSP00000119158
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 27 56 3.01e-4 SMART
ANK 60 89 3.41e-3 SMART
ANK 93 122 1.4e-4 SMART
ANK 126 155 3.26e0 SMART
ANK 167 196 3.33e-6 SMART
ANK 199 228 4.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175989
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that contains six ankyrin repeats, as well as a Src homology 3 (SH3) domain and two sterile alpha motif (SAM) domains, which may be involved in protein-protein interactions. The C-terminal portion of this protein is proline-rich and contains a conserved region. A related protein interacts with calcium/calmodulin-dependent serine protein kinase (CASK). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Caskin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Caskin2 APN 11 115803599 missense probably benign 0.00
IGL01936:Caskin2 APN 11 115804717 missense probably damaging 0.99
IGL02322:Caskin2 APN 11 115804477 missense probably damaging 0.99
R0119:Caskin2 UTSW 11 115802427 unclassified probably benign
R0127:Caskin2 UTSW 11 115800994 missense probably damaging 1.00
R0565:Caskin2 UTSW 11 115801016 missense probably damaging 1.00
R0741:Caskin2 UTSW 11 115804800 missense probably damaging 1.00
R1332:Caskin2 UTSW 11 115803345 unclassified probably benign
R1474:Caskin2 UTSW 11 115803696 missense probably benign 0.05
R1720:Caskin2 UTSW 11 115802782 missense probably damaging 1.00
R1968:Caskin2 UTSW 11 115803614 missense probably benign 0.00
R2054:Caskin2 UTSW 11 115806301 unclassified probably benign
R2061:Caskin2 UTSW 11 115803630 missense probably benign
R2893:Caskin2 UTSW 11 115801277 missense probably benign 0.00
R3036:Caskin2 UTSW 11 115806356 missense probably damaging 1.00
R3123:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R3124:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R4822:Caskin2 UTSW 11 115807299 missense probably damaging 1.00
R5095:Caskin2 UTSW 11 115800738 missense probably benign
R5743:Caskin2 UTSW 11 115802289 missense possibly damaging 0.66
R5801:Caskin2 UTSW 11 115803473 missense probably damaging 1.00
R5808:Caskin2 UTSW 11 115801763 missense probably damaging 1.00
R6259:Caskin2 UTSW 11 115800453 missense probably damaging 1.00
R6618:Caskin2 UTSW 11 115800029 missense possibly damaging 0.89
R7142:Caskin2 UTSW 11 115806736 missense probably benign 0.29
R7192:Caskin2 UTSW 11 115801376 missense probably damaging 1.00
R7247:Caskin2 UTSW 11 115801896 missense probably benign
R7290:Caskin2 UTSW 11 115804789 missense possibly damaging 0.63
X0063:Caskin2 UTSW 11 115806412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTGCTACGGAAGGATTCTC -3'
(R):5'- TAGAGTGGCCTACAGAGATCAC -3'

Sequencing Primer
(F):5'- TACGGAAGGATTCTCCAGCC -3'
(R):5'- CTACAGAGATCACTGGTGACTGTC -3'
Posted On2016-11-09