Incidental Mutation 'R5654:Nrcam'
ID442192
Institutional Source Beutler Lab
Gene Symbol Nrcam
Ensembl Gene ENSMUSG00000020598
Gene Nameneuronal cell adhesion molecule
SynonymsC030017F07Rik, Bravo, C130076O07Rik
MMRRC Submission 043300-MU
Accession Numbers

Genbank: NM_176930.4, NM_001146031.1,

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location44328885-44601964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44564058 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 520 (T520A)
Ref Sequence ENSEMBL: ENSMUSP00000151844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020939] [ENSMUST00000110748] [ENSMUST00000220123]
Predicted Effect probably benign
Transcript: ENSMUST00000020939
AA Change: T514A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020939
Gene: ENSMUSG00000020598
AA Change: T514A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
low complexity region 618 623 N/A INTRINSIC
FN3 641 724 3.24e-10 SMART
FN3 738 824 1.77e-2 SMART
FN3 840 931 1.97e-9 SMART
FN3 946 1031 3.73e-10 SMART
transmembrane domain 1120 1142 N/A INTRINSIC
Pfam:Bravo_FIGEY 1143 1232 2.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110748
AA Change: T514A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106376
Gene: ENSMUSG00000020598
AA Change: T514A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
FN3 631 714 3.24e-10 SMART
FN3 728 814 1.77e-2 SMART
FN3 830 921 1.97e-9 SMART
FN3 936 1021 3.73e-10 SMART
transmembrane domain 1050 1072 N/A INTRINSIC
Pfam:Bravo_FIGEY 1073 1164 9.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219906
Predicted Effect probably benign
Transcript: ENSMUST00000220123
AA Change: T520A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220130
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disorganization of lens fibers, cellular disintegration, and accumulation of cellular debris resulting in cataracts. Mutants show mild reductions in cerebellar lobe size. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(2) Chemically induced(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rab11fip3 A T 17: 26,016,064 V44E probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Nrcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Nrcam APN 12 44575884 missense probably benign 0.27
IGL01657:Nrcam APN 12 44559800 missense probably damaging 1.00
IGL02434:Nrcam APN 12 44590243 splice site probably benign
IGL02455:Nrcam APN 12 44570530 missense probably damaging 1.00
IGL02712:Nrcam APN 12 44573827 missense probably damaging 1.00
IGL02834:Nrcam APN 12 44541075 critical splice donor site probably null
IGL03022:Nrcam APN 12 44598442 missense probably damaging 1.00
IGL03174:Nrcam APN 12 44576006 splice site probably benign
IGL03389:Nrcam APN 12 44549906 missense probably benign 0.00
IGL03397:Nrcam APN 12 44559757 missense probably damaging 1.00
I2288:Nrcam UTSW 12 44564315 missense probably benign 0.06
I2289:Nrcam UTSW 12 44564315 missense probably benign 0.06
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0195:Nrcam UTSW 12 44584845 missense probably benign 0.00
R0463:Nrcam UTSW 12 44551341 missense probably damaging 1.00
R0590:Nrcam UTSW 12 44564032 missense probably damaging 1.00
R0674:Nrcam UTSW 12 44564322 missense probably benign 0.17
R0930:Nrcam UTSW 12 44549884 missense probably benign
R1241:Nrcam UTSW 12 44590164 missense probably damaging 1.00
R1279:Nrcam UTSW 12 44544877 unclassified probably null
R1523:Nrcam UTSW 12 44572249 missense probably damaging 1.00
R1572:Nrcam UTSW 12 44537364 splice site probably benign
R1629:Nrcam UTSW 12 44563986 missense probably benign 0.00
R1651:Nrcam UTSW 12 44576679 missense probably damaging 0.97
R1729:Nrcam UTSW 12 44573850 missense probably benign
R1739:Nrcam UTSW 12 44571675 missense probably damaging 1.00
R1803:Nrcam UTSW 12 44572208 missense probably benign
R1884:Nrcam UTSW 12 44544755 missense probably damaging 1.00
R1974:Nrcam UTSW 12 44563993 missense probably benign 0.05
R1992:Nrcam UTSW 12 44540970 missense probably damaging 1.00
R2102:Nrcam UTSW 12 44576688 missense probably benign 0.00
R2106:Nrcam UTSW 12 44570290 missense probably benign 0.12
R3854:Nrcam UTSW 12 44575884 missense probably benign 0.27
R4005:Nrcam UTSW 12 44532646 missense probably benign
R4088:Nrcam UTSW 12 44572202 missense possibly damaging 0.93
R4115:Nrcam UTSW 12 44566326 missense possibly damaging 0.87
R4428:Nrcam UTSW 12 44576775 missense possibly damaging 0.95
R4458:Nrcam UTSW 12 44559730 missense probably damaging 1.00
R4580:Nrcam UTSW 12 44562540 critical splice donor site probably null
R4601:Nrcam UTSW 12 44591056 missense probably damaging 1.00
R4688:Nrcam UTSW 12 44547237 missense probably benign
R4825:Nrcam UTSW 12 44575986 nonsense probably null
R4838:Nrcam UTSW 12 44574019 missense probably damaging 1.00
R4950:Nrcam UTSW 12 44598490 missense probably damaging 1.00
R4960:Nrcam UTSW 12 44566299 missense probably benign 0.01
R5081:Nrcam UTSW 12 44570353 missense probably benign 0.00
R5297:Nrcam UTSW 12 44544784 missense probably damaging 1.00
R5504:Nrcam UTSW 12 44564132 critical splice donor site probably null
R5593:Nrcam UTSW 12 44559700 missense probably damaging 1.00
R5691:Nrcam UTSW 12 44564256 missense probably damaging 1.00
R5890:Nrcam UTSW 12 44576771 missense probably benign
R5937:Nrcam UTSW 12 44572291 missense probably benign 0.00
R5980:Nrcam UTSW 12 44571633 missense probably damaging 1.00
R6132:Nrcam UTSW 12 44570224 missense probably damaging 1.00
R6213:Nrcam UTSW 12 44562432 missense possibly damaging 0.90
R6334:Nrcam UTSW 12 44572300 missense probably benign
R6617:Nrcam UTSW 12 44540963 missense probably damaging 1.00
R6666:Nrcam UTSW 12 44571555 missense probably damaging 1.00
R7191:Nrcam UTSW 12 44572244 missense probably benign 0.01
R7284:Nrcam UTSW 12 44564034 missense probably damaging 1.00
U24488:Nrcam UTSW 12 44537259 missense probably damaging 1.00
X0057:Nrcam UTSW 12 44551416 missense probably benign
X0066:Nrcam UTSW 12 44550029 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAATGTCTTTGACCTTGATGC -3'
(R):5'- TCAAAGGACACCTTGCTCCC -3'

Sequencing Primer
(F):5'- ATGCTTGCTGCTGGCCAC -3'
(R):5'- ACGACTGCATACTCAGGTTG -3'
Posted On2016-11-09