Incidental Mutation 'R5654:Rab11fip3'
ID442204
Institutional Source Beutler Lab
Gene Symbol Rab11fip3
Ensembl Gene ENSMUSG00000037098
Gene NameRAB11 family interacting protein 3 (class II)
SynonymsD030060O14Rik, Rab11-FIP3
MMRRC Submission 043300-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R5654 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25989036-26069409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26016064 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 44 (V44E)
Ref Sequence ENSEMBL: ENSMUSP00000119626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118828] [ENSMUST00000120691] [ENSMUST00000122103] [ENSMUST00000148021]
Predicted Effect probably damaging
Transcript: ENSMUST00000118828
AA Change: V22E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113048
Gene: ENSMUSG00000037098
AA Change: V22E

DomainStartEndE-ValueType
low complexity region 136 148 N/A INTRINSIC
low complexity region 313 333 N/A INTRINSIC
Blast:BRLZ 335 385 2e-11 BLAST
Pfam:RBD-FIP 404 444 2.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120691
AA Change: V625E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: V625E

DomainStartEndE-ValueType
internal_repeat_1 29 130 3.12e-31 PROSPERO
internal_repeat_1 144 294 3.12e-31 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 916 936 N/A INTRINSIC
Blast:BRLZ 938 988 2e-11 BLAST
Pfam:RBD-FIP 1007 1047 4.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122103
AA Change: V625E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: V625E

DomainStartEndE-ValueType
internal_repeat_1 29 130 2.03e-32 PROSPERO
internal_repeat_1 144 294 2.03e-32 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 784 796 N/A INTRINSIC
low complexity region 961 981 N/A INTRINSIC
Blast:BRLZ 983 1033 2e-11 BLAST
Pfam:RBD-FIP 1052 1092 4.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144587
Predicted Effect probably damaging
Transcript: ENSMUST00000148021
AA Change: V44E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 T C 1: 75,174,835 probably null Het
Abcc9 G A 6: 142,625,645 probably benign Het
Acss2 T C 2: 155,574,655 probably benign Het
Atp8b4 G A 2: 126,375,805 T597I probably damaging Het
Btaf1 A T 19: 36,983,615 N796I probably benign Het
Caskin2 T C 11: 115,800,079 probably null Het
Cdhr2 A G 13: 54,736,536 N1295D probably benign Het
Cog3 G A 14: 75,724,799 T534M probably benign Het
Cpne1 A G 2: 156,077,641 S303P probably damaging Het
Cs G A 10: 128,351,217 G74S possibly damaging Het
Cyb5r4 G T 9: 87,047,480 S229I probably damaging Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Ect2l C T 10: 18,143,062 V529M probably damaging Het
Edaradd C A 13: 12,478,280 R177L possibly damaging Het
Esf1 T C 2: 140,164,228 D333G possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fbxl18 A G 5: 142,885,803 I559T probably damaging Het
Fcrls A C 3: 87,257,544 V225G probably benign Het
Ido1 C T 8: 24,587,803 V83M probably damaging Het
Iffo1 T G 6: 125,153,067 C419G probably damaging Het
Igfals A T 17: 24,881,465 Y510F probably benign Het
Ipo9 A T 1: 135,385,472 Y1006* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jmjd1c T A 10: 67,230,006 S1737T probably benign Het
Klhl32 C T 4: 24,800,805 probably null Het
Klk11 T A 7: 43,778,386 C173S probably damaging Het
Klk1b24 A T 7: 44,191,465 M106L probably benign Het
Lamp1 G A 8: 13,171,388 probably null Het
Mapk4 A T 18: 73,970,294 V48E probably damaging Het
March6 A T 15: 31,485,936 D395E probably damaging Het
Mdp1 A G 14: 55,659,008 F157S probably damaging Het
Mettl21e A T 1: 44,211,095 F50L probably damaging Het
Mrgpra2a A G 7: 47,427,405 I35T probably benign Het
Natd1 T C 11: 60,906,066 Y91C probably damaging Het
Nbas T A 12: 13,583,475 Y2294N probably damaging Het
Nrcam A G 12: 44,564,058 T520A probably benign Het
Nrf1 A G 6: 30,117,062 T324A probably benign Het
Olfr1029 A G 2: 85,976,156 I304M probably benign Het
Olfr1301 T A 2: 111,754,981 I244N probably damaging Het
Olfr68 A C 7: 103,777,975 D123E probably damaging Het
Olfr714 G A 7: 107,074,187 A120T probably damaging Het
Pam C T 1: 97,864,398 V433I probably benign Het
Park2 C T 17: 11,237,649 A119V probably damaging Het
Pck1 T A 2: 173,158,560 Y595N probably damaging Het
Per2 C T 1: 91,445,501 probably null Het
Piezo2 G C 18: 63,145,091 F247L possibly damaging Het
Pkdcc A G 17: 83,215,908 Y148C probably damaging Het
Plod2 A G 9: 92,593,823 T320A probably benign Het
Ppip5k1 G A 2: 121,316,676 R1155C probably benign Het
Ppp1r15b C T 1: 133,131,644 probably benign Het
Ptprz1 G T 6: 22,986,134 C311F probably damaging Het
Rpl5 T A 5: 107,903,648 probably benign Het
Rttn G A 18: 89,048,432 V1201I probably benign Het
Sdk1 A G 5: 141,936,098 N283S probably damaging Het
Shank3 T A 15: 89,521,326 N418K probably benign Het
Shmt2 T C 10: 127,517,799 D499G probably benign Het
Slc25a46 A G 18: 31,583,240 L403S probably damaging Het
Slc5a1 A G 5: 33,146,611 T257A probably benign Het
Snrnp35 T C 5: 124,490,472 V116A probably benign Het
Spag9 T A 11: 94,090,712 F593I probably damaging Het
Tmem171 C A 13: 98,692,066 R192L probably benign Het
Trappc3l T A 10: 34,102,707 L169Q unknown Het
Ube2s T C 7: 4,808,432 E148G probably damaging Het
Uspl1 T C 5: 149,209,711 F424S probably damaging Het
Vmn1r2 T C 4: 3,172,261 V60A probably benign Het
Wdfy4 T C 14: 33,107,618 probably null Het
Zfp735 C T 11: 73,712,138 S636L possibly damaging Het
Zswim9 G A 7: 13,261,168 S354F probably damaging Het
Other mutations in Rab11fip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rab11fip3 APN 17 25991809 splice site probably benign
IGL00420:Rab11fip3 APN 17 26067625 missense probably benign 0.20
IGL01291:Rab11fip3 APN 17 26016113 missense probably damaging 0.99
IGL01473:Rab11fip3 APN 17 26068735 missense possibly damaging 0.53
IGL01687:Rab11fip3 APN 17 26067982 missense possibly damaging 0.96
IGL01764:Rab11fip3 APN 17 26068693 missense probably benign 0.02
IGL01977:Rab11fip3 APN 17 26068003 missense possibly damaging 0.72
IGL02140:Rab11fip3 APN 17 26067892 missense probably benign 0.33
IGL02434:Rab11fip3 APN 17 26068835 missense possibly damaging 0.85
IGL02549:Rab11fip3 APN 17 25994320 missense probably damaging 0.96
IGL02889:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
IGL02953:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
ANU05:Rab11fip3 UTSW 17 26016113 missense probably damaging 0.99
R0193:Rab11fip3 UTSW 17 25990999 missense probably damaging 0.99
R0388:Rab11fip3 UTSW 17 26069072 missense probably benign 0.33
R0543:Rab11fip3 UTSW 17 25994225 missense probably damaging 1.00
R0678:Rab11fip3 UTSW 17 26068847 missense probably benign 0.00
R1283:Rab11fip3 UTSW 17 26004554 missense probably damaging 1.00
R1473:Rab11fip3 UTSW 17 25991322 missense probably damaging 1.00
R1625:Rab11fip3 UTSW 17 26068891 missense possibly damaging 0.72
R1973:Rab11fip3 UTSW 17 26024391 missense probably damaging 0.97
R2160:Rab11fip3 UTSW 17 26069054 missense probably benign 0.33
R2197:Rab11fip3 UTSW 17 26068178 missense probably benign
R2382:Rab11fip3 UTSW 17 25990867 nonsense probably null
R3028:Rab11fip3 UTSW 17 26015942 critical splice donor site probably null
R3797:Rab11fip3 UTSW 17 26068526 missense possibly damaging 0.73
R4012:Rab11fip3 UTSW 17 26068028 frame shift probably null
R4064:Rab11fip3 UTSW 17 26024394 missense probably damaging 0.97
R4478:Rab11fip3 UTSW 17 26016083 missense probably damaging 1.00
R4527:Rab11fip3 UTSW 17 26036657 missense probably damaging 1.00
R4565:Rab11fip3 UTSW 17 26068706 missense possibly damaging 0.73
R5048:Rab11fip3 UTSW 17 26067580 critical splice donor site probably null
R5138:Rab11fip3 UTSW 17 25991026 missense probably benign 0.32
R5317:Rab11fip3 UTSW 17 26068078 missense possibly damaging 0.72
R5453:Rab11fip3 UTSW 17 25992581 critical splice donor site probably null
R5495:Rab11fip3 UTSW 17 26016143 missense probably damaging 0.99
R5525:Rab11fip3 UTSW 17 25991295 missense probably damaging 1.00
R5716:Rab11fip3 UTSW 17 26036664 missense probably damaging 1.00
R5818:Rab11fip3 UTSW 17 26016116 missense probably damaging 1.00
R6044:Rab11fip3 UTSW 17 26067869 missense possibly damaging 0.93
R6716:Rab11fip3 UTSW 17 25991057 missense probably damaging 1.00
R6785:Rab11fip3 UTSW 17 25991718 missense probably damaging 0.99
R7161:Rab11fip3 UTSW 17 26069090 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GACTCCAAGGGACACGCG -3'
(R):5'- AGCCAGTGTTGATGTTTAGGGAT -3'

Sequencing Primer
(F):5'- GGGACACGCGCACACAC -3'
(R):5'- GATAGCTATATCAGGCTCCTGTCAG -3'
Posted On2016-11-09