Incidental Mutation 'R5657:Epha2'
ID442375
Institutional Source Beutler Lab
Gene Symbol Epha2
Ensembl Gene ENSMUSG00000006445
Gene NameEph receptor A2
SynonymsMyk2, Eck, Sek-2, Sek2
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141301240-141329384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141323494 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 854 (C854R)
Ref Sequence ENSEMBL: ENSMUSP00000006614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006614]
Predicted Effect probably damaging
Transcript: ENSMUST00000006614
AA Change: C854R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445
AA Change: C854R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EPH_lbd 27 200 1.31e-112 SMART
FN3 330 420 1.16e-6 SMART
FN3 437 517 3.73e-10 SMART
Pfam:EphA2_TM 538 611 5.9e-22 PFAM
TyrKc 614 872 2.23e-135 SMART
SAM 902 969 1.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149002
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Epha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Epha2 APN 4 141318524 missense probably damaging 1.00
IGL02812:Epha2 APN 4 141318919 splice site probably benign
IGL03377:Epha2 APN 4 141322412 missense probably benign 0.08
R0165:Epha2 UTSW 4 141321892 critical splice donor site probably null
R0321:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R1584:Epha2 UTSW 4 141322047 intron probably null
R1586:Epha2 UTSW 4 141318605 splice site probably benign
R1695:Epha2 UTSW 4 141306517 missense possibly damaging 0.74
R1721:Epha2 UTSW 4 141322652 missense probably damaging 1.00
R1731:Epha2 UTSW 4 141321752 missense possibly damaging 0.81
R1813:Epha2 UTSW 4 141308546 missense possibly damaging 0.86
R1875:Epha2 UTSW 4 141308979 missense probably benign 0.02
R2226:Epha2 UTSW 4 141321237 missense probably damaging 1.00
R2314:Epha2 UTSW 4 141319014 missense probably damaging 1.00
R2342:Epha2 UTSW 4 141323531 missense probably benign 0.00
R3872:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R3927:Epha2 UTSW 4 141306550 missense probably damaging 1.00
R4688:Epha2 UTSW 4 141318981 missense probably benign
R4795:Epha2 UTSW 4 141322416 splice site probably null
R4974:Epha2 UTSW 4 141321705 missense probably damaging 0.99
R5055:Epha2 UTSW 4 141309069 missense probably benign 0.09
R5123:Epha2 UTSW 4 141308865 missense possibly damaging 0.71
R5424:Epha2 UTSW 4 141318940 nonsense probably null
R5522:Epha2 UTSW 4 141308556 missense probably damaging 1.00
R5717:Epha2 UTSW 4 141322071 missense probably benign
R5864:Epha2 UTSW 4 141308427 missense probably damaging 0.98
R6151:Epha2 UTSW 4 141318480 critical splice acceptor site probably null
R6244:Epha2 UTSW 4 141316912 missense probably benign 0.00
R6288:Epha2 UTSW 4 141317033 missense probably benign 0.01
R6696:Epha2 UTSW 4 141321539 missense probably benign
R6817:Epha2 UTSW 4 141308994 missense probably damaging 0.98
R6875:Epha2 UTSW 4 141328468 missense probably damaging 1.00
R6910:Epha2 UTSW 4 141321513 missense probably damaging 1.00
R6925:Epha2 UTSW 4 141308757 missense probably benign
R7330:Epha2 UTSW 4 141308453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTAGGAAAGGGTGCTGATCC -3'
(R):5'- CAGTTGTCCTGAGAAGCCAAG -3'

Sequencing Primer
(F):5'- GAAAGGGTGCTGATCCATTTC -3'
(R):5'- TTGTCCTGAGAAGCCAAGGAGTC -3'
Posted On2016-11-09