Incidental Mutation 'R5657:Foxm1'
ID442379
Institutional Source Beutler Lab
Gene Symbol Foxm1
Ensembl Gene ENSMUSG00000001517
Gene Nameforkhead box M1
SynonymsWIN, Mpm2, Foxm1b, Trident, Fkh16, HFH-11B
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128362967-128376146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128373388 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 551 (S551C)
Ref Sequence ENSEMBL: ENSMUSP00000107776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073316] [ENSMUST00000100926] [ENSMUST00000112148] [ENSMUST00000130785] [ENSMUST00000203040] [ENSMUST00000204223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073316
AA Change: S566C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073041
Gene: ENSMUSG00000001517
AA Change: S566C

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 429 454 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
low complexity region 685 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100926
SMART Domains Protein: ENSMUSP00000098486
Gene: ENSMUSG00000079304

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 306 1.9e-158 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112148
AA Change: S551C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107776
Gene: ENSMUSG00000001517
AA Change: S551C

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 414 439 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
low complexity region 518 531 N/A INTRINSIC
low complexity region 670 687 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125456
Predicted Effect probably benign
Transcript: ENSMUST00000130785
SMART Domains Protein: ENSMUSP00000145112
Gene: ENSMUSG00000079304

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 223 3.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153423
Predicted Effect probably benign
Transcript: ENSMUST00000203040
SMART Domains Protein: ENSMUSP00000145305
Gene: ENSMUSG00000001517

DomainStartEndE-ValueType
FH 78 165 1.2e-44 SMART
low complexity region 276 301 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203779
Predicted Effect probably benign
Transcript: ENSMUST00000204223
SMART Domains Protein: ENSMUSP00000145012
Gene: ENSMUSG00000108011

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele die in utero exhibiting reduced hepatoblast mitosis, impaired liver, bile duct and lung development, myocardial defects and ventricular hypoplasia. Most homozygotes for another null allele die perinatally with myocardialdefects and polyploidy in heart and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Foxm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Foxm1 APN 6 128370967 missense possibly damaging 0.94
IGL01312:Foxm1 APN 6 128373374 missense probably damaging 0.97
IGL01317:Foxm1 APN 6 128367353 missense probably damaging 0.98
IGL01683:Foxm1 APN 6 128373488 missense probably benign 0.01
IGL01837:Foxm1 APN 6 128366204 unclassified probably benign
IGL02039:Foxm1 APN 6 128369360 missense probably damaging 1.00
IGL02490:Foxm1 APN 6 128373351 nonsense probably null
IGL02685:Foxm1 APN 6 128373107 missense possibly damaging 0.89
IGL03335:Foxm1 APN 6 128372568 missense possibly damaging 0.92
R0374:Foxm1 UTSW 6 128372603 missense probably damaging 1.00
R0625:Foxm1 UTSW 6 128373871 missense probably damaging 1.00
R1420:Foxm1 UTSW 6 128372921 missense possibly damaging 0.94
R1471:Foxm1 UTSW 6 128373874 missense probably damaging 1.00
R2013:Foxm1 UTSW 6 128375502 unclassified probably null
R4334:Foxm1 UTSW 6 128365967 missense probably damaging 1.00
R4753:Foxm1 UTSW 6 128372556 missense probably null 0.89
R4834:Foxm1 UTSW 6 128369447 missense probably damaging 1.00
R4997:Foxm1 UTSW 6 128365768 missense probably benign 0.06
R5666:Foxm1 UTSW 6 128373167 missense possibly damaging 0.69
R5763:Foxm1 UTSW 6 128366108 missense probably benign 0.06
R5982:Foxm1 UTSW 6 128371035 missense probably damaging 1.00
R6164:Foxm1 UTSW 6 128373935 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCCAACTCCTGGGAAGATTCTTC -3'
(R):5'- TACTGGGCTGAAATCTAACCCC -3'

Sequencing Primer
(F):5'- GAAGATTCTTCCTGCTCTCCTAC -3'
(R):5'- CCAACTTTGGCTGGAGGTG -3'
Posted On2016-11-09