Incidental Mutation 'R5657:Trpc6'
ID442384
Institutional Source Beutler Lab
Gene Symbol Trpc6
Ensembl Gene ENSMUSG00000031997
Gene Nametransient receptor potential cation channel, subfamily C, member 6
Synonymsmtrp6, Trrp6
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location8544142-8680741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8609807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 92 (T92I)
Ref Sequence ENSEMBL: ENSMUSP00000057965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596] [ENSMUST00000217462]
Predicted Effect probably benign
Transcript: ENSMUST00000050433
AA Change: T92I

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997
AA Change: T92I

DomainStartEndE-ValueType
low complexity region 37 54 N/A INTRINSIC
ANK 96 125 4.73e2 SMART
ANK 131 159 3.49e0 SMART
ANK 217 246 6.61e-1 SMART
Pfam:TRP_2 252 314 4e-29 PFAM
transmembrane domain 406 427 N/A INTRINSIC
Pfam:Ion_trans 442 738 4.2e-38 PFAM
Pfam:PKD_channel 477 733 3.1e-16 PFAM
low complexity region 770 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214596
AA Change: T92I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000217462
AA Change: T92I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Trpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Trpc6 APN 9 8680438 missense probably damaging 1.00
IGL00469:Trpc6 APN 9 8626701 missense probably benign
IGL00970:Trpc6 APN 9 8653151 missense probably damaging 1.00
IGL01299:Trpc6 APN 9 8653061 missense probably damaging 1.00
IGL01563:Trpc6 APN 9 8656603 missense probably damaging 1.00
IGL01578:Trpc6 APN 9 8634057 missense probably damaging 1.00
IGL02657:Trpc6 APN 9 8643601 missense possibly damaging 0.94
IGL02735:Trpc6 APN 9 8655338 missense probably damaging 1.00
IGL03102:Trpc6 APN 9 8649301 missense probably benign 0.07
P0038:Trpc6 UTSW 9 8649511 missense possibly damaging 0.52
PIT4531001:Trpc6 UTSW 9 8610148 missense probably benign 0.14
R0100:Trpc6 UTSW 9 8653034 missense probably damaging 1.00
R0100:Trpc6 UTSW 9 8653034 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8610275 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8643536 missense probably damaging 1.00
R0334:Trpc6 UTSW 9 8610343 missense probably damaging 1.00
R0665:Trpc6 UTSW 9 8634122 missense probably benign 0.11
R0948:Trpc6 UTSW 9 8610415 missense possibly damaging 0.60
R1177:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1217:Trpc6 UTSW 9 8658286 intron probably null
R1445:Trpc6 UTSW 9 8680537 missense probably benign 0.00
R1452:Trpc6 UTSW 9 8653147 missense probably damaging 0.99
R1494:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1501:Trpc6 UTSW 9 8610169 missense probably damaging 0.99
R1933:Trpc6 UTSW 9 8656545 missense probably damaging 1.00
R2112:Trpc6 UTSW 9 8656612 missense probably damaging 1.00
R2164:Trpc6 UTSW 9 8610465 nonsense probably null
R2921:Trpc6 UTSW 9 8653033 missense possibly damaging 0.94
R2995:Trpc6 UTSW 9 8544466 missense probably benign 0.30
R3821:Trpc6 UTSW 9 8610278 missense probably damaging 1.00
R3965:Trpc6 UTSW 9 8626621 missense probably damaging 1.00
R4360:Trpc6 UTSW 9 8610266 missense probably benign 0.10
R4625:Trpc6 UTSW 9 8677962 missense probably benign 0.40
R4691:Trpc6 UTSW 9 8652978 missense probably damaging 1.00
R4736:Trpc6 UTSW 9 8609870 missense probably damaging 1.00
R4767:Trpc6 UTSW 9 8643686 missense probably damaging 1.00
R4773:Trpc6 UTSW 9 8609851 missense possibly damaging 0.78
R4792:Trpc6 UTSW 9 8626614 missense probably benign 0.00
R5105:Trpc6 UTSW 9 8649470 missense probably benign
R5319:Trpc6 UTSW 9 8609921 missense probably damaging 1.00
R5429:Trpc6 UTSW 9 8634074 nonsense probably null
R5505:Trpc6 UTSW 9 8626735 missense probably damaging 1.00
R5684:Trpc6 UTSW 9 8653128 missense probably damaging 1.00
R5722:Trpc6 UTSW 9 8680549 missense possibly damaging 0.88
R6210:Trpc6 UTSW 9 8656730 missense probably benign 0.42
R6284:Trpc6 UTSW 9 8643600 missense possibly damaging 0.93
R6773:Trpc6 UTSW 9 8634057 missense probably damaging 1.00
R6874:Trpc6 UTSW 9 8680438 missense probably damaging 1.00
R7032:Trpc6 UTSW 9 8609950 missense probably damaging 1.00
R7142:Trpc6 UTSW 9 8653016 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGTCTAGAGATGCTGAGGC -3'
(R):5'- GCTCTGTGATTTCCAAGTGC -3'

Sequencing Primer
(F):5'- ATTGCATTAGGTGAATGACAGGTC -3'
(R):5'- AAGTGCTCATTGGCCACAG -3'
Posted On2016-11-09