Incidental Mutation 'R5657:Plppr2'
ID442385
Institutional Source Beutler Lab
Gene Symbol Plppr2
Ensembl Gene ENSMUSG00000040563
Gene Namephospholipid phosphatase related 2
SynonymsLppr2, PRG-4, BC018242
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5657 (G1)
Quality Score219
Status Not validated
Chromosome9
Chromosomal Location21937033-21948907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21947615 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 343 (C343R)
Ref Sequence ENSEMBL: ENSMUSP00000038616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046371] [ENSMUST00000188468] [ENSMUST00000190387]
Predicted Effect probably damaging
Transcript: ENSMUST00000046371
AA Change: C343R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038616
Gene: ENSMUSG00000040563
AA Change: C343R

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
acidPPc 130 281 2.31e-9 SMART
low complexity region 363 422 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188468
AA Change: C318R

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140166
Gene: ENSMUSG00000040563
AA Change: C318R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
transmembrane domain 46 63 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
acidPPc 105 256 1.1e-11 SMART
low complexity region 338 397 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000190387
SMART Domains Protein: ENSMUSP00000139727
Gene: ENSMUSG00000040563

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
acidPPc 130 281 2.31e-9 SMART
low complexity region 322 336 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Plppr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Plppr2 APN 9 21943446 missense possibly damaging 0.94
R0630:Plppr2 UTSW 9 21947901 missense probably benign 0.39
R1418:Plppr2 UTSW 9 21947789 missense possibly damaging 0.77
R1682:Plppr2 UTSW 9 21944421 missense possibly damaging 0.93
R1813:Plppr2 UTSW 9 21947924 missense probably damaging 0.99
R1830:Plppr2 UTSW 9 21947751 missense probably damaging 1.00
R1970:Plppr2 UTSW 9 21941126 missense probably damaging 0.99
R4807:Plppr2 UTSW 9 21944514 missense probably damaging 1.00
R5192:Plppr2 UTSW 9 21941132 missense probably damaging 1.00
R5196:Plppr2 UTSW 9 21941132 missense probably damaging 1.00
R5205:Plppr2 UTSW 9 21941074 missense probably damaging 0.99
R5568:Plppr2 UTSW 9 21941129 missense probably damaging 1.00
R6273:Plppr2 UTSW 9 21944505 missense probably damaging 1.00
R7138:Plppr2 UTSW 9 21944412 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCCATCCAGTAAGTTTTGGG -3'
(R):5'- GTGTACAGGTCCCTTAGCAG -3'

Sequencing Primer
(F):5'- CCATCCAGTAAGTTTTGGGGAAGTG -3'
(R):5'- TGTTGGCTCAGACCTCAG -3'
Posted On2016-11-09