Incidental Mutation 'R5668:Khdrbs2'
ID442406
Institutional Source Beutler Lab
Gene Symbol Khdrbs2
Ensembl Gene ENSMUSG00000026058
Gene NameKH domain containing, RNA binding, signal transduction associated 2
Synonyms6330586C16Rik, SLM-1
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5668 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location32172714-32658568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32467770 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 165 (D165V)
Ref Sequence ENSEMBL: ENSMUSP00000027226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226]
Predicted Effect probably damaging
Transcript: ENSMUST00000027226
AA Change: D165V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058
AA Change: D165V

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to the src associated in mitosis, 68 kDa protein, which is an RNA-binding protein and a substrate for Src-family tyrosine kinases during mitosis. This protein has a KH RNA-binding motif and proline-rich motifs which may be SH2 and SH3 domain binding sites. A similar rat protein is an RNA-binding protein which is tyrosine phosphorylated by Src during mitosis. These studies also suggest that the rat protein may function as an adaptor protein for Src by binding the SH2 and SH3 domains of various other proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals display smaller brain size and reduced weight in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Khdrbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Khdrbs2 APN 1 32472752 missense probably benign 0.00
IGL01326:Khdrbs2 APN 1 32657477 missense possibly damaging 0.94
IGL01767:Khdrbs2 APN 1 32619176 nonsense probably null
IGL01792:Khdrbs2 APN 1 32657467 missense probably damaging 0.99
IGL01839:Khdrbs2 APN 1 32414862 splice site probably benign
R0046:Khdrbs2 UTSW 1 32619202 missense possibly damaging 0.56
R0079:Khdrbs2 UTSW 1 32519915 intron probably null
R0396:Khdrbs2 UTSW 1 32519973 missense probably damaging 1.00
R0613:Khdrbs2 UTSW 1 32657522 missense possibly damaging 0.94
R0616:Khdrbs2 UTSW 1 32467775 missense possibly damaging 0.65
R1034:Khdrbs2 UTSW 1 32467791 missense probably damaging 1.00
R1055:Khdrbs2 UTSW 1 32644157 splice site probably benign
R1156:Khdrbs2 UTSW 1 32467875 missense probably benign 0.04
R1456:Khdrbs2 UTSW 1 32520696 missense possibly damaging 0.71
R2007:Khdrbs2 UTSW 1 32520548 missense probably benign 0.04
R2079:Khdrbs2 UTSW 1 32467874 missense probably benign
R2384:Khdrbs2 UTSW 1 32519895 missense probably damaging 0.97
R3123:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3124:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3772:Khdrbs2 UTSW 1 32244076 nonsense probably null
R4078:Khdrbs2 UTSW 1 32519814 intron probably benign
R4088:Khdrbs2 UTSW 1 32333524 missense probably damaging 1.00
R4955:Khdrbs2 UTSW 1 32520077 intron probably benign
R5465:Khdrbs2 UTSW 1 32619174 missense probably damaging 1.00
R5792:Khdrbs2 UTSW 1 32472692 missense probably damaging 1.00
R6639:Khdrbs2 UTSW 1 32467862 nonsense probably null
R7027:Khdrbs2 UTSW 1 32414916 missense probably benign 0.02
R7380:Khdrbs2 UTSW 1 32333604 missense unknown
R7381:Khdrbs2 UTSW 1 32333802 missense not run
X0020:Khdrbs2 UTSW 1 32414974 missense probably damaging 1.00
Z1088:Khdrbs2 UTSW 1 32244055 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGCTTTGAAGGAAGGCCTGG -3'
(R):5'- ACCTGTGGTCATCATCTGC -3'

Sequencing Primer
(F):5'- CTGGAACTAGACTCAGCTCTG -3'
(R):5'- GCTGTCATCATCTGCTGTTAATACG -3'
Posted On2016-11-09