Incidental Mutation 'R5668:Gm14412'
ID442416
Institutional Source Beutler Lab
Gene Symbol Gm14412
Ensembl Gene ENSMUSG00000078868
Gene Namepredicted gene 14412
Synonyms
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R5668 (G1)
Quality Score155
Status Validated
Chromosome2
Chromosomal Location177314520-177324307 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 177315609 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 164 (C164*)
Ref Sequence ENSEMBL: ENSMUSP00000104587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108959]
Predicted Effect probably null
Transcript: ENSMUST00000108959
AA Change: C164*
SMART Domains Protein: ENSMUSP00000104587
Gene: ENSMUSG00000078868
AA Change: C164*

DomainStartEndE-ValueType
KRAB 4 66 1.54e-15 SMART
ZnF_C2H2 103 125 1.12e-3 SMART
ZnF_C2H2 131 153 2.15e-5 SMART
ZnF_C2H2 159 181 5.59e-4 SMART
ZnF_C2H2 187 209 1.98e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 6.52e-5 SMART
ZnF_C2H2 271 293 1.12e-3 SMART
ZnF_C2H2 299 321 5.59e-4 SMART
ZnF_C2H2 327 349 4.87e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 9.08e-4 SMART
ZnF_C2H2 411 433 4.87e-4 SMART
ZnF_C2H2 439 461 6.88e-4 SMART
ZnF_C2H2 467 489 4.61e-5 SMART
ZnF_C2H2 495 517 8.02e-5 SMART
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Gm14412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm14412 APN 2 177315686 missense probably benign
R0124:Gm14412 UTSW 2 177315912 splice site probably benign
R0507:Gm14412 UTSW 2 177314532 missense possibly damaging 0.46
R1833:Gm14412 UTSW 2 177315790 missense probably benign 0.00
R1908:Gm14412 UTSW 2 177315476 missense probably damaging 1.00
R1908:Gm14412 UTSW 2 177315837 missense probably benign 0.03
R2026:Gm14412 UTSW 2 177317105 missense possibly damaging 0.92
R2209:Gm14412 UTSW 2 177317436 missense probably damaging 1.00
R2656:Gm14412 UTSW 2 177315200 missense unknown
R3946:Gm14412 UTSW 2 177314685 nonsense probably null
R4430:Gm14412 UTSW 2 177315832 missense probably benign 0.09
R4537:Gm14412 UTSW 2 177314559 missense probably benign 0.06
R4595:Gm14412 UTSW 2 177315212 missense unknown
R4928:Gm14412 UTSW 2 177314580 missense probably benign 0.01
R5100:Gm14412 UTSW 2 177315115 missense probably damaging 0.99
R5434:Gm14412 UTSW 2 177314612 missense probably damaging 1.00
R6173:Gm14412 UTSW 2 177314537 missense probably damaging 1.00
R6558:Gm14412 UTSW 2 177314554 missense probably damaging 0.99
R6784:Gm14412 UTSW 2 177317340 missense probably benign 0.10
R7094:Gm14412 UTSW 2 177317345 missense probably damaging 1.00
R7182:Gm14412 UTSW 2 177315615 missense probably benign 0.44
R7254:Gm14412 UTSW 2 177317396 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTCTGCAAAGGCTTTACCAC -3'
(R):5'- GCCTTTGCATATGAGAGTCATAGTC -3'

Sequencing Primer
(F):5'- GCAAAGGCTTTACCACATTGTTTAC -3'
(R):5'- ACCATGACTGTAACCAATGTGG -3'
Posted On2016-11-09