Incidental Mutation 'R5668:Maz'
ID442442
Institutional Source Beutler Lab
Gene Symbol Maz
Ensembl Gene ENSMUSG00000030678
Gene NameMYC-associated zinc finger protein (purine-binding transcription factor)
SynonymsSAF-2, Pur-1, PUR1, SAF-1
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R5668 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127022130-127027037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127025322 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 342 (C342Y)
Ref Sequence ENSEMBL: ENSMUSP00000032916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000032916] [ENSMUST00000159916] [ENSMUST00000202045] [ENSMUST00000202624] [ENSMUST00000205461] [ENSMUST00000205568] [ENSMUST00000206254] [ENSMUST00000206291]
Predicted Effect probably benign
Transcript: ENSMUST00000032915
SMART Domains Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677

DomainStartEndE-ValueType
KISc 36 371 1.12e-140 SMART
low complexity region 399 428 N/A INTRINSIC
coiled coil region 460 496 N/A INTRINSIC
HhH1 597 616 2.16e0 SMART
HhH1 627 646 8.65e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000032916
AA Change: C342Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032916
Gene: ENSMUSG00000030678
AA Change: C342Y

DomainStartEndE-ValueType
low complexity region 59 82 N/A INTRINSIC
low complexity region 90 126 N/A INTRINSIC
low complexity region 130 179 N/A INTRINSIC
ZnF_C2H2 190 212 4.11e-2 SMART
low complexity region 231 272 N/A INTRINSIC
ZnF_C2H2 279 301 6.78e-3 SMART
ZnF_C2H2 307 329 4.87e-4 SMART
ZnF_C2H2 337 360 1.22e-4 SMART
ZnF_C2H2 366 388 1.79e-2 SMART
ZnF_C2H2 392 413 6.57e0 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032918
SMART Domains Protein: ENSMUSP00000032918
Gene: ENSMUSG00000030680

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 217 7.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159916
SMART Domains Protein: ENSMUSP00000124520
Gene: ENSMUSG00000045114

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
Pfam:CD225 263 337 3.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201963
Predicted Effect probably benign
Transcript: ENSMUST00000202045
SMART Domains Protein: ENSMUSP00000144042
Gene: ENSMUSG00000045114

DomainStartEndE-ValueType
Pfam:CD225 1 52 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202624
SMART Domains Protein: ENSMUSP00000144099
Gene: ENSMUSG00000107068

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:PAXIP1_C 85 176 5.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202936
Predicted Effect probably benign
Transcript: ENSMUST00000205461
Predicted Effect probably damaging
Transcript: ENSMUST00000205568
AA Change: C342Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000205754
Predicted Effect probably damaging
Transcript: ENSMUST00000206254
AA Change: C319Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000206291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206953
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Maz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Maz APN 7 127024442 critical splice donor site probably null
R0049:Maz UTSW 7 127024586 missense probably damaging 1.00
R0049:Maz UTSW 7 127024586 missense probably damaging 1.00
R1381:Maz UTSW 7 127023152 nonsense probably null
R2114:Maz UTSW 7 127025505 missense probably damaging 1.00
R4628:Maz UTSW 7 127025347 missense possibly damaging 0.92
R4629:Maz UTSW 7 127025347 missense possibly damaging 0.92
R4895:Maz UTSW 7 127025300 unclassified probably null
R5479:Maz UTSW 7 127025688 missense possibly damaging 0.79
R7008:Maz UTSW 7 127024612 missense probably damaging 1.00
R7324:Maz UTSW 7 127024593 missense probably damaging 1.00
R7325:Maz UTSW 7 127025553 missense probably benign 0.35
R7432:Maz UTSW 7 127023048 missense probably benign 0.33
R7456:Maz UTSW 7 127026317 nonsense probably null
X0035:Maz UTSW 7 127025883 unclassified probably benign
Z1088:Maz UTSW 7 127024474 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGAGGCTGCTTTCCTTCAG -3'
(R):5'- GAAGCGCATCCGGAAGAATC -3'

Sequencing Primer
(F):5'- GCTTTCCTTCAGCCCAGAGAC -3'
(R):5'- AATCACGCCTGCGAGATGTG -3'
Posted On2016-11-09